header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-171006-2
Morpholino Name: MO5-isl2a
Target: isl2a (1)
Previous Name: e4i4 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AAATAAGCTTTCCTACCGTTTTGTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO5-isl2a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO5-isl2a No data available
PHENOTYPE
Phenotype resulting from MO5-isl2a
Phenotype of all Fish created by or utilizing MO5-isl2a
Phenotype Fish Conditions Figures
dorsal aorta mrc1a expression mislocalised, abnormal TL + MO4-isl2a + MO5-isl2a control Fig. 2 with image from Lamont et al., 2016
posterior cardinal vein flt4 expression decreased distribution, abnormal TL + MO4-isl2a + MO5-isl2a control Fig. 2 with image from Lamont et al., 2016
whole organism flt4 expression decreased amount, abnormal TL + MO4-isl2a + MO5-isl2a control Fig. 2 with image from Lamont et al., 2016
posterior cardinal vein mrc1a expression decreased distribution, abnormal TL + MO4-isl2a + MO5-isl2a control Fig. 2 with image from Lamont et al., 2016
angioblastic mesenchymal cell mislocalised, abnormal TL + MO4-isl2a + MO5-isl2a control Fig. 3 with image from Lamont et al., 2016
angioblastic mesenchymal cell irregular spatial pattern, abnormal TL + MO4-isl2a + MO5-isl2a control Fig. 3 with image from Lamont et al., 2016
whole organism fli1a expression decreased amount, abnormal TL + MO4-isl2a + MO5-isl2a control Fig. 3 with image from Lamont et al., 2016
posterior lateral mesoderm angioblastic mesenchymal cell etv2 expression spatial pattern, abnormal TL + MO4-isl2a + MO5-isl2a control Fig. 3 with image from Lamont et al., 2016
angioblastic mesenchymal cell decreased amount, abnormal TL + MO4-isl2a + MO5-isl2a control Fig. 3 with image from Lamont et al., 2016
intersegmental artery sprouting angiogenesis decreased process quality, abnormal y7Tg + MO4-isl2a + MO5-isl2a standard conditions Fig. 1 with image from Lamont et al., 2016
intersegmental artery blood vessel endothelial cell decreased amount, abnormal y7Tg + MO4-isl2a + MO5-isl2a control Fig. 1 with imageFig. 5 with image from Lamont et al., 2016
posterior cardinal vein blood vessel endothelial cell decreased amount, abnormal y7Tg + MO5-isl2a standard conditions Fig. 1 with image from Lamont et al., 2016
intersegmental artery blood vessel endothelial cell amount, ameliorated y7Tg + MO4-isl2a + MO4-rbpja,rbpjb + MO5-isl2a control Fig. 5 with image from Lamont et al., 2016
OTHER MO5-isl2a MORPHOLINO PAGESNo links to external sites
CITATIONS (1)