header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-171006-1
Morpholino Name: MO4-isl2a
Target: isl2a (1)
Sequence:
5' - ATGCGGTAGAATATCCACCATACAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-isl2a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-isl2a No data available
PHENOTYPE
Phenotype resulting from MO4-isl2a
Phenotype of all Fish created by or utilizing MO4-isl2a
Phenotype Fish Conditions Figures
dorsal aorta mrc1a expression mislocalised, abnormal TL + MO4-isl2a + MO5-isl2a control Fig. 2 with image from Lamont et al., 2016
posterior cardinal vein flt4 expression decreased distribution, abnormal TL + MO4-isl2a + MO5-isl2a control Fig. 2 with image from Lamont et al., 2016
whole organism flt4 expression decreased amount, abnormal TL + MO4-isl2a + MO5-isl2a control Fig. 2 with image from Lamont et al., 2016
posterior cardinal vein mrc1a expression decreased distribution, abnormal TL + MO4-isl2a + MO5-isl2a control Fig. 2 with image from Lamont et al., 2016
angioblastic mesenchymal cell mislocalised, abnormal TL + MO4-isl2a + MO5-isl2a control Fig. 3 with image from Lamont et al., 2016
angioblastic mesenchymal cell irregular spatial pattern, abnormal TL + MO4-isl2a + MO5-isl2a control Fig. 3 with image from Lamont et al., 2016
whole organism fli1a expression decreased amount, abnormal TL + MO4-isl2a + MO5-isl2a control Fig. 3 with image from Lamont et al., 2016
posterior lateral mesoderm angioblastic mesenchymal cell etv2 expression spatial pattern, abnormal TL + MO4-isl2a + MO5-isl2a control Fig. 3 with image from Lamont et al., 2016
angioblastic mesenchymal cell decreased amount, abnormal TL + MO4-isl2a + MO5-isl2a control Fig. 3 with image from Lamont et al., 2016
intersegmental artery sprouting angiogenesis decreased process quality, abnormal y7Tg + MO4-isl2a + MO5-isl2a standard conditions Fig. 1 with image from Lamont et al., 2016
intersegmental artery blood vessel endothelial cell decreased amount, abnormal y7Tg + MO4-isl2a + MO5-isl2a control Fig. 1 with imageFig. 5 with image from Lamont et al., 2016
angioblast cell migration delayed, abnormal ci5Tg; y7Tg + MO4-isl2a standard conditions Fig. 1 with image from Lamont et al., 2016
intersegmental artery blood vessel endothelial cell amount, ameliorated y7Tg + MO4-isl2a + MO4-rbpja,rbpjb + MO5-isl2a control Fig. 5 with image from Lamont et al., 2016
OTHER MO4-isl2a MORPHOLINO PAGESNo links to external sites
CITATIONS (1)