Morpholino

MO4-pycard

ID
ZDB-MRPHLNO-170915-8
Name
MO4-pycard
Previous Names
None
Target
Sequence
5' - GCTGCTCCTTGAAAGATTCCGCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-pycard
Phenotype
Phenotype resulting from MO4-pycard
Phenotype of all Fish created by or utilizing MO4-pycard
Phenotype Fish Conditions Figures
whole organism decreased life span, abnormal WT + MO4-pycard bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 7 with image from Tyrkalska et al., 2017
cysteine-type endopeptidase activity involved in apoptotic process decreased process quality, abnormal WT + MO4-pycard bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 7 with image from Tyrkalska et al., 2017
innate immune response decreased process quality, abnormal WT + MO4-pycard bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 7 with image from Tyrkalska et al., 2017
nucleate erythrocyte increased amount, abnormal cz3325Tg + MO4-pycard control Fig. 1 from Tyrkalska et al., 2019
neutrophil decreased amount, abnormal i114Tg + MO4-pycard control Fig. 1Fig. 4 from Tyrkalska et al., 2019
cysteine-type endopeptidase activity involved in apoptotic process decreased occurrence, abnormal i114Tg + MO4-pycard control Fig. 1Fig. 4 from Tyrkalska et al., 2019
cysteine-type endopeptidase activity involved in apoptotic process decreased occurrence, abnormal c264Tg; utn6Tg + MO4-pycard control Fig. 2 from Tyrkalska et al., 2019
cysteine-type endopeptidase activity involved in apoptotic process decreased process quality, abnormal WT + MO1-caiap + MO4-pycard bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 7 with image from Tyrkalska et al., 2017
innate immune response decreased process quality, abnormal WT + MO1-caiap + MO4-pycard bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 7 with image from Tyrkalska et al., 2017
whole organism decreased life span, abnormal WT + MO1-caiap + MO4-pycard bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 7 with image from Tyrkalska et al., 2017
whole organism gata1a expression increased amount, abnormal mitfaw2/w2; mpv17a9/a9 + MO4-pycard control Fig. 4 from Tyrkalska et al., 2019
whole organism decreased life span, exacerbated mitfaw2/w2; mpv17a9/a9 + MO4-pycard bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 4 from Tyrkalska et al., 2019
whole organism Ab2-gata1a labeling increased amount, abnormal mitfaw2/w2; mpv17a9/a9 + MO4-pycard control Fig. 4 from Tyrkalska et al., 2019
whole organism spi1b expression increased amount, abnormal mitfaw2/w2; mpv17a9/a9 + MO4-pycard control Fig. 4 from Tyrkalska et al., 2019
Citations