Morpholino

MO3-sept15

ID
ZDB-MRPHLNO-170831-3
Name
MO3-sept15
Previous Names
None
Target
Sequence
5' - ACTCACCTTAAACAGGAAAGCAAGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-sept15
No data available
Phenotype
Phenotype resulting from MO3-sept15
Phenotype of all Fish created by or utilizing MO3-sept15
Citations