ZFIN ID: ZDB-MRPHLNO-170831-3
Morpholino Name: MO3-sept15
Target: sept15 (1)
Sequence:
5' - ACTCACCTTAAACAGGAAAGCAAGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-sept15 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-sept15 No data available
PHENOTYPE
Phenotype resulting from MO3-sept15
Phenotype of all Fish created by or utilizing MO3-sept15
Genome Resources:
CITATIONS (1)