Morpholino

MO3-usb1

ID
ZDB-MRPHLNO-170809-6
Name
MO3-usb1
Previous Names
None
Target
Sequence
5' - GGATCATCTGAAATTTAGGCAGGAA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-usb1
Expressed Gene Anatomy Figures
gata1a Fig. 5 with image from Colombo et al., 2015
mpx Fig. 5 with image from Colombo et al., 2015
Phenotype
Phenotype resulting from MO3-usb1
Phenotype Fish Figures
ceratohyal cartilage displaced, abnormal AB + MO3-usb1 Fig. 4 with image from Colombo et al., 2015
ceratohyal cartilage kinked, abnormal AB + MO3-usb1 Fig. 4 with image from Colombo et al., 2015
head decreased size, abnormal AB + MO3-usb1 Fig. 4 with image from Colombo et al., 2015
Meckel's cartilage misaligned with palatoquadrate cartilage, abnormal AB + MO3-usb1 Fig. 4 with image from Colombo et al., 2015
Meckel's cartilage shape, abnormal AB + MO3-usb1 Fig. 4 with image from Colombo et al., 2015
neutrophil decreased amount, abnormal AB + MO3-usb1 Fig. 4 with image,  Fig. 5 with image,  Fig. 6 with image from Colombo et al., 2015
neutrophil GFP expression decreased amount, abnormal i114Tg; nz50Tg + MO3-usb1 Fig. 4 with image,  Fig. 6 with image from Colombo et al., 2015
neutrophil mpx expression decreased amount, abnormal AB + MO3-usb1 Fig. 5 with image from Colombo et al., 2015
neutrophil GFP expression decreased distribution, abnormal i114Tg; nz50Tg + MO3-usb1 Fig. 4 with image,  Fig. 6 with image from Colombo et al., 2015
neutrophil mpx expression decreased distribution, abnormal AB + MO3-usb1 Fig. 5 with image from Colombo et al., 2015
nucleate erythrocyte decreased amount, abnormal s843Tg; sd2Tg + MO3-usb1 Fig. 4 with image,  Fig. 5 with image from Colombo et al., 2015
pericardium edematous, abnormal AB + MO3-usb1 Fig. 4 with image from Colombo et al., 2015
pharyngeal arch 3-7 aplastic/hypoplastic, abnormal AB + MO3-usb1 Fig. 4 with image from Colombo et al., 2015
pigmentation process quality, abnormal AB + MO3-usb1 Fig. 4 with image from Colombo et al., 2015
trunk edematous, abnormal AB + MO3-usb1 Fig. 4 with image from Colombo et al., 2015
whole organism mpx expression decreased amount, abnormal AB + MO3-usb1 Fig. 5 with image from Colombo et al., 2015
whole organism decreased size, abnormal AB + MO3-usb1 Fig. 4 with image from Colombo et al., 2015
yolk edematous, abnormal AB + MO3-usb1 Fig. 4 with image from Colombo et al., 2015
Phenotype of all Fish created by or utilizing MO3-usb1
Phenotype Fish Conditions Figures
head decreased size, abnormal AB + MO3-usb1 standard conditions Fig. 4 with image from Colombo et al., 2015
trunk edematous, abnormal AB + MO3-usb1 control Fig. 4 with image from Colombo et al., 2015
pigmentation process quality, abnormal AB + MO3-usb1 standard conditions Fig. 4 with image from Colombo et al., 2015
Meckel's cartilage shape, abnormal AB + MO3-usb1 control Fig. 4 with image from Colombo et al., 2015
ceratohyal cartilage kinked, abnormal AB + MO3-usb1 control Fig. 4 with image from Colombo et al., 2015
neutrophil mpx expression decreased amount, abnormal AB + MO3-usb1 control Fig. 5 with image from Colombo et al., 2015
Meckel's cartilage misaligned with palatoquadrate cartilage, abnormal AB + MO3-usb1 control Fig. 4 with image from Colombo et al., 2015
yolk edematous, abnormal AB + MO3-usb1 control Fig. 4 with image from Colombo et al., 2015
nucleate erythrocyte decreased amount, abnormal AB + MO3-usb1 control Fig. 5 with image from Colombo et al., 2015
ceratohyal cartilage displaced, abnormal AB + MO3-usb1 control Fig. 4 with image from Colombo et al., 2015
pericardium edematous, abnormal AB + MO3-usb1 standard conditions Fig. 4 with image from Colombo et al., 2015
pharyngeal arch 3-7 aplastic/hypoplastic, abnormal AB + MO3-usb1 control Fig. 4 with image from Colombo et al., 2015
neutrophil mpx expression decreased distribution, abnormal AB + MO3-usb1 control Fig. 5 with image from Colombo et al., 2015
whole organism mpx expression decreased amount, abnormal AB + MO3-usb1 control Fig. 5 with image from Colombo et al., 2015
neutrophil decreased amount, abnormal AB + MO3-usb1 control Fig. 5 with image from Colombo et al., 2015
whole organism decreased size, abnormal AB + MO3-usb1 control Fig. 4 with image from Colombo et al., 2015
pericardium edematous, abnormal AB + MO3-usb1 + MO4-usb1 control Fig. 6 with image from Colombo et al., 2015
head decreased size, abnormal AB + MO3-usb1 + MO4-usb1 control Fig. 6 with image from Colombo et al., 2015
pharyngeal arch cartilage morphology, abnormal AB + MO3-usb1 + MO4-usb1 control Fig. 6 with image from Colombo et al., 2015
neutrophil GFP expression decreased amount, abnormal i114Tg; nz50Tg + MO3-usb1 control Fig. 4 with image,  Fig. 6 with image from Colombo et al., 2015
neutrophil GFP expression decreased distribution, abnormal i114Tg; nz50Tg + MO3-usb1 control Fig. 4 with image,  Fig. 6 with image from Colombo et al., 2015
neutrophil decreased amount, abnormal i114Tg; nz50Tg + MO3-usb1 control Fig. 4 with image,  Fig. 6 with image from Colombo et al., 2015
nucleate erythrocyte decreased amount, abnormal s843Tg; sd2Tg + MO3-usb1 control Fig. 4 with image from Colombo et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.