Morpholino

MO3-usb1

ID
ZDB-MRPHLNO-170809-6
Name
MO3-usb1
Previous Names
None
Target
Sequence
5' - GGATCATCTGAAATTTAGGCAGGAA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-usb1
Phenotype
Phenotype resulting from MO3-usb1
Phenotype Fish Figures
ceratohyal cartilage displaced, abnormal AB + MO3-usb1 Fig. 4 with image from Colombo et al., 2015
ceratohyal cartilage kinked, abnormal AB + MO3-usb1 Fig. 4 with image from Colombo et al., 2015
head decreased size, abnormal AB + MO3-usb1 Fig. 4 with image from Colombo et al., 2015
Meckel's cartilage misaligned with palatoquadrate cartilage, abnormal AB + MO3-usb1 Fig. 4 with image from Colombo et al., 2015
Meckel's cartilage shape, abnormal AB + MO3-usb1 Fig. 4 with image from Colombo et al., 2015
neutrophil decreased amount, abnormal i114Tg; nz50Tg + MO3-usb1 Fig. 4 with imageFig. 5 with imageFig. 6 with image from Colombo et al., 2015
neutrophil GFP expression decreased amount, abnormal i114Tg; nz50Tg + MO3-usb1 Fig. 4 with imageFig. 6 with image from Colombo et al., 2015
neutrophil mpx expression decreased amount, abnormal AB + MO3-usb1 Fig. 5 with image from Colombo et al., 2015
neutrophil GFP expression decreased distribution, abnormal i114Tg; nz50Tg + MO3-usb1 Fig. 4 with imageFig. 6 with image from Colombo et al., 2015
neutrophil mpx expression decreased distribution, abnormal AB + MO3-usb1 Fig. 5 with image from Colombo et al., 2015
nucleate erythrocyte decreased amount, abnormal AB + MO3-usb1 Fig. 4 with imageFig. 5 with image from Colombo et al., 2015
pericardium edematous, abnormal AB + MO3-usb1 Fig. 4 with image from Colombo et al., 2015
pharyngeal arch 3-7 aplastic/hypoplastic, abnormal AB + MO3-usb1 Fig. 4 with image from Colombo et al., 2015
pigmentation process quality, abnormal AB + MO3-usb1 Fig. 4 with image from Colombo et al., 2015
trunk edematous, abnormal AB + MO3-usb1 Fig. 4 with image from Colombo et al., 2015
whole organism mpx expression decreased amount, abnormal AB + MO3-usb1 Fig. 5 with image from Colombo et al., 2015
whole organism decreased size, abnormal AB + MO3-usb1 Fig. 4 with image from Colombo et al., 2015
yolk edematous, abnormal AB + MO3-usb1 Fig. 4 with image from Colombo et al., 2015
Phenotype of all Fish created by or utilizing MO3-usb1
Phenotype Fish Conditions Figures
head decreased size, abnormal AB + MO3-usb1 standard conditions Fig. 4 with image from Colombo et al., 2015
trunk edematous, abnormal AB + MO3-usb1 control Fig. 4 with image from Colombo et al., 2015
pigmentation process quality, abnormal AB + MO3-usb1 standard conditions Fig. 4 with image from Colombo et al., 2015
Meckel's cartilage shape, abnormal AB + MO3-usb1 control Fig. 4 with image from Colombo et al., 2015
ceratohyal cartilage kinked, abnormal AB + MO3-usb1 control Fig. 4 with image from Colombo et al., 2015
neutrophil mpx expression decreased amount, abnormal AB + MO3-usb1 control Fig. 5 with image from Colombo et al., 2015
Meckel's cartilage misaligned with palatoquadrate cartilage, abnormal AB + MO3-usb1 control Fig. 4 with image from Colombo et al., 2015
yolk edematous, abnormal AB + MO3-usb1 control Fig. 4 with image from Colombo et al., 2015
nucleate erythrocyte decreased amount, abnormal AB + MO3-usb1 control Fig. 5 with image from Colombo et al., 2015
ceratohyal cartilage displaced, abnormal AB + MO3-usb1 control Fig. 4 with image from Colombo et al., 2015
pericardium edematous, abnormal AB + MO3-usb1 standard conditions Fig. 4 with image from Colombo et al., 2015
pharyngeal arch 3-7 aplastic/hypoplastic, abnormal AB + MO3-usb1 control Fig. 4 with image from Colombo et al., 2015
neutrophil mpx expression decreased distribution, abnormal AB + MO3-usb1 control Fig. 5 with image from Colombo et al., 2015
whole organism mpx expression decreased amount, abnormal AB + MO3-usb1 control Fig. 5 with image from Colombo et al., 2015
neutrophil decreased amount, abnormal AB + MO3-usb1 control Fig. 5 with image from Colombo et al., 2015
whole organism decreased size, abnormal AB + MO3-usb1 control Fig. 4 with image from Colombo et al., 2015
pericardium edematous, abnormal AB + MO3-usb1 + MO4-usb1 control Fig. 6 with image from Colombo et al., 2015
head decreased size, abnormal AB + MO3-usb1 + MO4-usb1 control Fig. 6 with image from Colombo et al., 2015
pharyngeal arch cartilage morphology, abnormal AB + MO3-usb1 + MO4-usb1 control Fig. 6 with image from Colombo et al., 2015
neutrophil GFP expression decreased amount, abnormal i114Tg; nz50Tg + MO3-usb1 control Fig. 4 with imageFig. 6 with image from Colombo et al., 2015
neutrophil GFP expression decreased distribution, abnormal i114Tg; nz50Tg + MO3-usb1 control Fig. 4 with imageFig. 6 with image from Colombo et al., 2015
neutrophil decreased amount, abnormal i114Tg; nz50Tg + MO3-usb1 control Fig. 4 with imageFig. 6 with image from Colombo et al., 2015
nucleate erythrocyte decreased amount, abnormal s843Tg; sd2Tg + MO3-usb1 control Fig. 4 with image from Colombo et al., 2015
Citations