Morpholino

MO1-tm6sf2b

ID
ZDB-MRPHLNO-170719-2
Name
MO1-tm6sf2b
Previous Names
  • MO1-tm6sf2
  • tm6sf2_e4 (1)
Target
Sequence
5' - CCTCATGTCATTACGCTAACCGTTT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tm6sf2b
Expressed Gene Anatomy Figures
ddit3 Fig. 3,  Fig. 5 from O'Hare et al., 2017
edem1 Fig. 3,  Fig. 5 from O'Hare et al., 2017
hspa5 Fig. 3,  Fig. 5 from O'Hare et al., 2017
xbp1 Fig. 3,  Fig. 5 from O'Hare et al., 2017
Phenotype
Phenotype resulting from MO1-tm6sf2b
Phenotype Fish Figures
enterocyte endoplasmic reticulum lumen increased width, abnormal WT + MO1-tm6sf2b Fig. 6 from O'Hare et al., 2017
enterocyte lipid droplet increased amount, abnormal WT + MO1-tm6sf2b Fig. 6 from O'Hare et al., 2017
intestine fatty, abnormal WT + MO1-tm6sf2b Fig. 6 from O'Hare et al., 2017
liver fatty, abnormal WT + MO1-tm6sf2b Fig. 2,  Fig. 5,  Fig. S3 from O'Hare et al., 2017
liver ddit3 expression increased amount, abnormal WT + MO1-tm6sf2b Fig. 3 from O'Hare et al., 2017
liver edem1 expression increased amount, abnormal WT + MO1-tm6sf2b Fig. 3 from O'Hare et al., 2017
liver xbp1 expression increased amount, abnormal WT + MO1-tm6sf2b Fig. 3 from O'Hare et al., 2017
liver hspa5 expression increased amount, abnormal WT + MO1-tm6sf2b Fig. 3 from O'Hare et al., 2017
liver endoplasmic reticulum lumen dilated, abnormal WT + MO1-tm6sf2b Fig. S6 from O'Hare et al., 2017
liver endoplasmic reticulum lumen increased width, abnormal WT + MO1-tm6sf2b Fig. S6 from O'Hare et al., 2017
liver lipid droplet increased amount, abnormal WT + MO1-tm6sf2b Fig. 2,  Fig. 3,  Fig. 5 from O'Hare et al., 2017
whole organism edem1 expression increased amount, abnormal WT + MO1-tm6sf2b Fig. 5 from O'Hare et al., 2017
whole organism xbp1 expression increased amount, abnormal WT + MO1-tm6sf2b Fig. 5 from O'Hare et al., 2017
whole organism ddit3 expression increased amount, abnormal WT + MO1-tm6sf2b Fig. 5 from O'Hare et al., 2017
whole organism hspa5 expression increased amount, abnormal WT + MO1-tm6sf2b Fig. 5 from O'Hare et al., 2017
whole organism low-density lipoprotein particle decreased amount, abnormal WT + MO1-tm6sf2b Fig. 2 from O'Hare et al., 2017
Phenotype of all Fish created by or utilizing MO1-tm6sf2b
Phenotype Fish Conditions Figures
enterocyte lipid droplet increased amount, abnormal WT + MO1-tm6sf2b high fat Fig. 7 from O'Hare et al., 2017
liver hspa5 expression increased amount, abnormal WT + MO1-tm6sf2b standard conditions Fig. 3 from O'Hare et al., 2017
liver endoplasmic reticulum lumen increased width, abnormal WT + MO1-tm6sf2b standard conditions Fig. S6 from O'Hare et al., 2017
whole organism ddit3 expression increased amount, abnormal WT + MO1-tm6sf2b standard conditions Fig. 5 from O'Hare et al., 2017
whole organism low-density lipoprotein particle decreased amount, abnormal WT + MO1-tm6sf2b standard conditions Fig. 2 from O'Hare et al., 2017
liver fatty, abnormal WT + MO1-tm6sf2b standard conditions Fig. 2,  Fig. 5,  Fig. S3 from O'Hare et al., 2017
whole organism xbp1 expression increased amount, abnormal WT + MO1-tm6sf2b standard conditions Fig. 5 from O'Hare et al., 2017
liver edem1 expression increased amount, abnormal WT + MO1-tm6sf2b standard conditions Fig. 3 from O'Hare et al., 2017
whole organism edem1 expression increased amount, abnormal WT + MO1-tm6sf2b standard conditions Fig. 5 from O'Hare et al., 2017
enterocyte endoplasmic reticulum lumen increased width, abnormal WT + MO1-tm6sf2b standard conditions Fig. 6 from O'Hare et al., 2017
intestine fatty, abnormal WT + MO1-tm6sf2b standard conditions Fig. 6 from O'Hare et al., 2017
liver ddit3 expression increased amount, abnormal WT + MO1-tm6sf2b standard conditions Fig. 3 from O'Hare et al., 2017
whole organism hspa5 expression increased amount, abnormal WT + MO1-tm6sf2b standard conditions Fig. 5 from O'Hare et al., 2017
liver xbp1 expression increased amount, abnormal WT + MO1-tm6sf2b standard conditions Fig. 3 from O'Hare et al., 2017
liver lipid droplet increased amount, abnormal WT + MO1-tm6sf2b standard conditions Fig. 2,  Fig. 3,  Fig. 5 from O'Hare et al., 2017
intestine lipid homeostasis disrupted, abnormal WT + MO1-tm6sf2b high fat Fig. 7 from O'Hare et al., 2017
liver endoplasmic reticulum lumen dilated, abnormal WT + MO1-tm6sf2b standard conditions Fig. S6 from O'Hare et al., 2017
enterocyte lipid droplet increased amount, abnormal WT + MO1-tm6sf2b standard conditions Fig. 6 from O'Hare et al., 2017
liver fatty, abnormal trappc11hi1532bTg/hi1532bTg + MO1-tm6sf2b standard conditions Fig. 4 from O'Hare et al., 2017
whole organism edem1 expression amount, ameliorated WT + MO1-dgat2 + MO1-tm6sf2b standard conditions Fig. 5 from O'Hare et al., 2017
liver lipid droplet amount, ameliorated WT + MO1-dgat2 + MO1-tm6sf2b standard conditions Fig. 5 from O'Hare et al., 2017
liver morphology, ameliorated WT + MO1-dgat2 + MO1-tm6sf2b standard conditions Fig. 5 from O'Hare et al., 2017
whole organism xbp1 expression amount, ameliorated WT + MO1-dgat2 + MO1-tm6sf2b standard conditions Fig. 5 from O'Hare et al., 2017
whole organism ddit3 expression amount, ameliorated WT + MO1-dgat2 + MO1-tm6sf2b standard conditions Fig. 5 from O'Hare et al., 2017
whole organism hspa5 expression amount, ameliorated WT + MO1-dgat2 + MO1-tm6sf2b standard conditions Fig. 5 from O'Hare et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.