ZFIN ID: ZDB-MRPHLNO-170501-1
Morpholino Name: MO1-net1
Target: net1 (1)
Sequence:
5' - CTTGCTCCGGCTGTACTCACCTCTT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-net1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-net1
Expressed Gene Anatomy Figures
apoeb Fig. S1 from Wei et al., 2017
bmp2b Fig. 1 from Wei et al., 2017
cdx4 Fig. 2 from Wei et al., 2017
chrd Fig. 1Fig. 2Fig. 3Fig. 4Fig. 5Fig. 7 from Wei et al., 2017
dharma Fig. 1Fig. 2Fig. 3Fig. 4Fig. 5Fig. 7 from Wei et al., 2017
foxa1 Fig. 1 with image from Wei et al., 2017
fscn1a Fig. 2 with image from Wei et al., 2017
gata2a Fig. 1 from Wei et al., 2017
gsc Fig. 1 from Wei et al., 2017
Fig. 1 with imageFig. 3 with image from Wei et al., 2017
hhex Fig. 1 with image from Wei et al., 2017
lrwd1 Fig. S1 from Wei et al., 2017
ndr2 Fig. 2 with image from Wei et al., 2017
nkx2.3 Fig. 1 with image from Wei et al., 2017
shha Fig. 1 with image from Wei et al., 2017
si:dkey-23i12.5 Fig. S1 from Wei et al., 2017
sox3 Fig. 1 from Wei et al., 2017
sox11a Fig. S1 from Wei et al., 2017
sox17 Fig. 1 with imageFig. 3 with image from Wei et al., 2017
sox32 Fig. 1 with image from Wei et al., 2017
tbx6 Fig. 2 from Wei et al., 2017
tbxta Fig. 1 with image from Wei et al., 2017
PHENOTYPE
Phenotype resulting from MO1-net1
Phenotype Figures
dorsal/ventral axis specification decreased process quality, abnormal Fig. 1 from Wei et al., 2017
endoderm sox17 expression decreased amount, abnormal Fig. 1 with imageFig. 3 with image from Wei et al., 2017
endoderm sox32 expression decreased amount, abnormal Fig. 1 with image from Wei et al., 2017
endoderm foxa1 expression decreased amount, abnormal Fig. 1 with image from Wei et al., 2017
liver hhex expression decreased amount, abnormal Fig. 1 with image from Wei et al., 2017
liver primordium hhex expression decreased amount, abnormal Fig. 1 with image from Wei et al., 2017
mesoderm tbxta expression decreased amount, abnormal Fig. 1 with image from Wei et al., 2017
mesoderm gsc expression decreased amount, abnormal Fig. 1 with image from Wei et al., 2017
neuroectoderm dorsal region sox3 expression decreased amount, abnormal Fig. 1 from Wei et al., 2017
neuroectoderm dorsal region sox3 expression decreased distribution, abnormal Fig. 1 from Wei et al., 2017
non neural ectoderm ventral region gata2a expression increased distribution, abnormal Fig. 1 from Wei et al., 2017
notochord shha expression decreased amount, abnormal Fig. 1 with image from Wei et al., 2017
notochord tbxta expression decreased amount, abnormal Fig. 1 with image from Wei et al., 2017
notochord tbxta expression spatial pattern, abnormal Fig. 1 with image from Wei et al., 2017
notochord shha expression spatial pattern, abnormal Fig. 1 with image from Wei et al., 2017
pancreas primordium hhex expression decreased amount, abnormal Fig. 1 with image from Wei et al., 2017
pancreatic bud hhex expression decreased amount, abnormal Fig. 1 with image from Wei et al., 2017
pharyngeal pouch nkx2.3 expression decreased amount, abnormal Fig. 1 with image from Wei et al., 2017
presumptive endoderm ndr2 expression decreased amount, abnormal Fig. 2 with image from Wei et al., 2017
presumptive endoderm sox17 expression decreased amount, abnormal Fig. 1 with image from Wei et al., 2017
presumptive endoderm sox32 expression decreased amount, abnormal Fig. 1 with image from Wei et al., 2017
presumptive endoderm fscn1a expression decreased amount, abnormal Fig. 2 with image from Wei et al., 2017
presumptive mesoderm gsc expression decreased amount, abnormal Fig. 1 with image from Wei et al., 2017
presumptive mesoderm tbxta expression decreased amount, abnormal Fig. 1 with image from Wei et al., 2017
presumptive mesoderm ventro-lateral region cdx4 expression decreased amount, abnormal Fig. 2 from Wei et al., 2017
presumptive mesoderm ventro-lateral region tbx6 expression decreased amount, abnormal Fig. 2 from Wei et al., 2017
presumptive mesoderm ventro-lateral region GFP expression decreased amount, abnormal Fig. 2 from Wei et al., 2017
presumptive mesoderm ventro-lateral region cdx4 expression decreased distribution, abnormal Fig. 2 from Wei et al., 2017
presumptive mesoderm ventro-lateral region GFP expression decreased distribution, abnormal Fig. 2 from Wei et al., 2017
presumptive mesoderm ventro-lateral region tbx6 expression decreased distribution, abnormal Fig. 2 from Wei et al., 2017
shield chrd expression decreased amount, abnormal Fig. 1Fig. 2 from Wei et al., 2017
shield GFP expression decreased amount, abnormal Fig. 2 from Wei et al., 2017
shield dharma expression decreased amount, abnormal Fig. 2 from Wei et al., 2017
shield gsc expression decreased amount, abnormal Fig. 1 from Wei et al., 2017
Fig. 3 with image from Wei et al., 2017
shield gsc expression decreased distribution, abnormal Fig. 1 from Wei et al., 2017
shield GFP expression decreased distribution, abnormal Fig. 2 from Wei et al., 2017
shield chrd expression decreased distribution, abnormal Fig. 1Fig. 2 from Wei et al., 2017
shield dharma expression decreased distribution, abnormal Fig. 2 from Wei et al., 2017
whole organism Ab15-ctnnb labeling decreased amount, abnormal Fig. 4Fig. 5 from Wei et al., 2017
whole organism gsc expression decreased amount, abnormal Fig. 1 from Wei et al., 2017
whole organism chrd expression decreased amount, abnormal Fig. 1 from Wei et al., 2017
whole organism dharma expression decreased amount, abnormal Fig. 1 from Wei et al., 2017
whole organism wholly ventralized, abnormal Fig. 1 from Wei et al., 2017
whole organism dorsal region chrd expression decreased amount, abnormal Fig. 1Fig. 3Fig. 4Fig. 5Fig. 7 from Wei et al., 2017
whole organism dorsal region dharma expression decreased amount, abnormal Fig. 1Fig. 3Fig. 4Fig. 5Fig. 7 from Wei et al., 2017
whole organism dorsal region dharma expression decreased distribution, abnormal Fig. 1Fig. 3Fig. 4Fig. 5Fig. 7 from Wei et al., 2017
whole organism dorsal region chrd expression decreased distribution, abnormal Fig. 1Fig. 3Fig. 4Fig. 5Fig. 7 from Wei et al., 2017
whole organism ventral region bmp2b expression increased distribution, abnormal Fig. 1 from Wei et al., 2017

Phenotype of all Fish created by or utilizing MO1-net1
Phenotype Fish Conditions Figures
presumptive endoderm ndr2 expression decreased amount, abnormal TU + MO1-net1 standard conditions Fig. 2 with image from Wei et al., 2017
endoderm sox32 expression decreased amount, abnormal TU + MO1-net1 standard conditions Fig. 1 with image from Wei et al., 2017
notochord shha expression decreased amount, abnormal TU + MO1-net1 standard conditions Fig. 1 with image from Wei et al., 2017
liver hhex expression decreased amount, abnormal TU + MO1-net1 standard conditions Fig. 1 with image from Wei et al., 2017
endoderm sox17 expression decreased amount, abnormal TU + MO1-net1 standard conditions Fig. 1 with imageFig. 3 with image from Wei et al., 2017
shield gsc expression decreased amount, abnormal TU + MO1-net1 standard conditions Fig. 3 with image from Wei et al., 2017
presumptive endoderm sox32 expression decreased amount, abnormal TU + MO1-net1 standard conditions Fig. 1 with image from Wei et al., 2017
endoderm foxa1 expression decreased amount, abnormal TU + MO1-net1 standard conditions Fig. 1 with image from Wei et al., 2017
pancreas primordium hhex expression decreased amount, abnormal TU + MO1-net1 standard conditions Fig. 1 with image from Wei et al., 2017
presumptive mesoderm gsc expression decreased amount, abnormal TU + MO1-net1 standard conditions Fig. 1 with image from Wei et al., 2017
notochord shha expression spatial pattern, abnormal TU + MO1-net1 standard conditions Fig. 1 with image from Wei et al., 2017
mesoderm gsc expression decreased amount, abnormal TU + MO1-net1 standard conditions Fig. 1 with image from Wei et al., 2017
notochord tbxta expression decreased amount, abnormal TU + MO1-net1 standard conditions Fig. 1 with image from Wei et al., 2017
pancreatic bud hhex expression decreased amount, abnormal TU + MO1-net1 standard conditions Fig. 1 with image from Wei et al., 2017
mesoderm tbxta expression decreased amount, abnormal TU + MO1-net1 standard conditions Fig. 1 with image from Wei et al., 2017
liver primordium hhex expression decreased amount, abnormal TU + MO1-net1 standard conditions Fig. 1 with image from Wei et al., 2017
pharyngeal pouch nkx2.3 expression decreased amount, abnormal TU + MO1-net1 standard conditions Fig. 1 with image from Wei et al., 2017
presumptive mesoderm tbxta expression decreased amount, abnormal TU + MO1-net1 standard conditions Fig. 1 with image from Wei et al., 2017
presumptive endoderm sox17 expression decreased amount, abnormal TU + MO1-net1 standard conditions Fig. 1 with image from Wei et al., 2017
presumptive endoderm fscn1a expression decreased amount, abnormal TU + MO1-net1 standard conditions Fig. 2 with image from Wei et al., 2017
notochord tbxta expression spatial pattern, abnormal TU + MO1-net1 standard conditions Fig. 1 with image from Wei et al., 2017
shield dharma expression decreased amount, abnormal WT + MO1-net1 standard conditions Fig. 2 from Wei et al., 2017
shield dharma expression decreased distribution, abnormal WT + MO1-net1 standard conditions Fig. 2 from Wei et al., 2017
presumptive mesoderm ventro-lateral region tbx6 expression decreased amount, abnormal WT + MO1-net1 standard conditions Fig. 2 from Wei et al., 2017
whole organism dorsal region chrd expression decreased amount, abnormal WT + MO1-net1 standard conditions Fig. 1Fig. 3Fig. 4Fig. 5Fig. 7 from Wei et al., 2017
shield chrd expression decreased distribution, abnormal WT + MO1-net1 standard conditions Fig. 1Fig. 2 from Wei et al., 2017
whole organism gsc expression decreased amount, abnormal WT + MO1-net1 standard conditions Fig. 1 from Wei et al., 2017
non neural ectoderm ventral region gata2a expression increased distribution, abnormal WT + MO1-net1 standard conditions Fig. 1 from Wei et al., 2017
neuroectoderm dorsal region sox3 expression decreased amount, abnormal WT + MO1-net1 standard conditions Fig. 1 from Wei et al., 2017
neuroectoderm dorsal region sox3 expression decreased distribution, abnormal WT + MO1-net1 standard conditions Fig. 1 from Wei et al., 2017
whole organism dharma expression decreased amount, abnormal WT + MO1-net1 standard conditions Fig. 1 from Wei et al., 2017
shield chrd expression decreased amount, abnormal WT + MO1-net1 standard conditions Fig. 1Fig. 2 from Wei et al., 2017
whole organism chrd expression decreased amount, abnormal WT + MO1-net1 standard conditions Fig. 1 from Wei et al., 2017
shield gsc expression decreased distribution, abnormal WT + MO1-net1 standard conditions Fig. 1 from Wei et al., 2017
presumptive mesoderm ventro-lateral region cdx4 expression decreased distribution, abnormal WT + MO1-net1 standard conditions Fig. 2 from Wei et al., 2017
dorsal/ventral axis specification decreased process quality, abnormal WT + MO1-net1 standard conditions Fig. 1 from Wei et al., 2017
shield gsc expression decreased amount, abnormal WT + MO1-net1 standard conditions Fig. 1 from Wei et al., 2017
whole organism ventral region bmp2b expression increased distribution, abnormal WT + MO1-net1 standard conditions Fig. 1 from Wei et al., 2017
presumptive mesoderm ventro-lateral region cdx4 expression decreased amount, abnormal WT + MO1-net1 standard conditions Fig. 2 from Wei et al., 2017
presumptive mesoderm ventro-lateral region tbx6 expression decreased distribution, abnormal WT + MO1-net1 standard conditions Fig. 2 from Wei et al., 2017
whole organism dorsal region chrd expression decreased distribution, abnormal WT + MO1-net1 standard conditions Fig. 1Fig. 3Fig. 4Fig. 5Fig. 7 from Wei et al., 2017
whole organism wholly ventralized, abnormal WT + MO1-net1 standard conditions Fig. 1 from Wei et al., 2017
whole organism dorsal region dharma expression decreased amount, abnormal WT + MO1-net1 standard conditions Fig. 1Fig. 3Fig. 4Fig. 5Fig. 7 from Wei et al., 2017
whole organism dorsal region dharma expression decreased distribution, abnormal WT + MO1-net1 standard conditions Fig. 1Fig. 3Fig. 4Fig. 5Fig. 7 from Wei et al., 2017
whole organism Ab15-ctnnb labeling decreased amount, abnormal WT + MO1-net1 standard conditions Fig. 4Fig. 5 from Wei et al., 2017
presumptive mesoderm ventro-lateral region GFP expression decreased amount, abnormal w25Tg + MO1-net1 standard conditions Fig. 2 from Wei et al., 2017
shield GFP expression decreased amount, abnormal w25Tg + MO1-net1 standard conditions Fig. 2 from Wei et al., 2017
shield GFP expression decreased distribution, abnormal w25Tg + MO1-net1 standard conditions Fig. 2 from Wei et al., 2017
presumptive mesoderm ventro-lateral region GFP expression decreased distribution, abnormal w25Tg + MO1-net1 standard conditions Fig. 2 from Wei et al., 2017
Genome Resources:
CITATIONS (2)