Morpholino

MO1-net1

ID
ZDB-MRPHLNO-170501-1
Name
MO1-net1
Previous Names
None
Target
Sequence
5' - CTTGCTCCGGCTGTACTCACCTCTT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-net1
Expressed Gene Anatomy Figures
apoeb Fig. S1 from Wei et al., 2017
bmp2b Fig. 1 from Wei et al., 2017
cdx4 Fig. 2 from Wei et al., 2017
chrd Fig. 1,  Fig. 2,  Fig. 3,  Fig. 4,  Fig. 5,  Fig. 7 from Wei et al., 2017
dharma Fig. 1,  Fig. 2,  Fig. 3,  Fig. 4,  Fig. 5,  Fig. 7 from Wei et al., 2017
foxa1 Fig. 1 with image from Wei et al., 2017
fscn1a Fig. 2 with image from Wei et al., 2017
gata2a Fig. 1 from Wei et al., 2017
gsc Fig. 1 from Wei et al., 2017
Fig. 1 with image,  Fig. 3 with image from Wei et al., 2017
hhex Fig. 1 with image from Wei et al., 2017
lrwd1 Fig. S1 from Wei et al., 2017
ndr2 Fig. 2 with image from Wei et al., 2017
nkx2.3 Fig. 1 with image from Wei et al., 2017
shha Fig. 1 with image from Wei et al., 2017
si:dkey-23i12.5 Fig. S1 from Wei et al., 2017
sox3 Fig. 1 from Wei et al., 2017
sox11a Fig. S1 from Wei et al., 2017
sox17 Fig. 1 with image,  Fig. 3 with image from Wei et al., 2017
sox32 Fig. 1 with image from Wei et al., 2017
tbx6 Fig. 2 from Wei et al., 2017
tbxta Fig. 1 with image from Wei et al., 2017
Phenotype
Phenotype resulting from MO1-net1
Phenotype Fish Figures
dorsal/ventral axis specification decreased process quality, abnormal WT + MO1-net1 Fig. 1 from Wei et al., 2017
endoderm sox17 expression decreased amount, abnormal TU + MO1-net1 Fig. 1 with image,  Fig. 3 with image from Wei et al., 2017
endoderm sox32 expression decreased amount, abnormal TU + MO1-net1 Fig. 1 with image from Wei et al., 2017
endoderm foxa1 expression decreased amount, abnormal TU + MO1-net1 Fig. 1 with image from Wei et al., 2017
liver hhex expression decreased amount, abnormal TU + MO1-net1 Fig. 1 with image from Wei et al., 2017
liver primordium hhex expression decreased amount, abnormal TU + MO1-net1 Fig. 1 with image from Wei et al., 2017
mesoderm tbxta expression decreased amount, abnormal TU + MO1-net1 Fig. 1 with image from Wei et al., 2017
mesoderm gsc expression decreased amount, abnormal TU + MO1-net1 Fig. 1 with image from Wei et al., 2017
neuroectoderm dorsal region sox3 expression decreased amount, abnormal WT + MO1-net1 Fig. 1 from Wei et al., 2017
neuroectoderm dorsal region sox3 expression decreased distribution, abnormal WT + MO1-net1 Fig. 1 from Wei et al., 2017
non neural ectoderm ventral region gata2a expression increased distribution, abnormal WT + MO1-net1 Fig. 1 from Wei et al., 2017
notochord shha expression decreased amount, abnormal TU + MO1-net1 Fig. 1 with image from Wei et al., 2017
notochord tbxta expression decreased amount, abnormal TU + MO1-net1 Fig. 1 with image from Wei et al., 2017
notochord tbxta expression spatial pattern, abnormal TU + MO1-net1 Fig. 1 with image from Wei et al., 2017
notochord shha expression spatial pattern, abnormal TU + MO1-net1 Fig. 1 with image from Wei et al., 2017
pancreas primordium hhex expression decreased amount, abnormal TU + MO1-net1 Fig. 1 with image from Wei et al., 2017
pancreatic bud hhex expression decreased amount, abnormal TU + MO1-net1 Fig. 1 with image from Wei et al., 2017
pharyngeal pouch nkx2.3 expression decreased amount, abnormal TU + MO1-net1 Fig. 1 with image from Wei et al., 2017
presumptive endoderm ndr2 expression decreased amount, abnormal TU + MO1-net1 Fig. 2 with image from Wei et al., 2017
presumptive endoderm sox17 expression decreased amount, abnormal TU + MO1-net1 Fig. 1 with image from Wei et al., 2017
presumptive endoderm sox32 expression decreased amount, abnormal TU + MO1-net1 Fig. 1 with image from Wei et al., 2017
presumptive endoderm fscn1a expression decreased amount, abnormal TU + MO1-net1 Fig. 2 with image from Wei et al., 2017
presumptive mesoderm gsc expression decreased amount, abnormal TU + MO1-net1 Fig. 1 with image from Wei et al., 2017
presumptive mesoderm tbxta expression decreased amount, abnormal TU + MO1-net1 Fig. 1 with image from Wei et al., 2017
presumptive mesoderm ventro-lateral region cdx4 expression decreased amount, abnormal WT + MO1-net1 Fig. 2 from Wei et al., 2017
presumptive mesoderm ventro-lateral region tbx6 expression decreased amount, abnormal WT + MO1-net1 Fig. 2 from Wei et al., 2017
presumptive mesoderm ventro-lateral region GFP expression decreased amount, abnormal w25Tg + MO1-net1 Fig. 2 from Wei et al., 2017
presumptive mesoderm ventro-lateral region cdx4 expression decreased distribution, abnormal WT + MO1-net1 Fig. 2 from Wei et al., 2017
presumptive mesoderm ventro-lateral region GFP expression decreased distribution, abnormal w25Tg + MO1-net1 Fig. 2 from Wei et al., 2017
presumptive mesoderm ventro-lateral region tbx6 expression decreased distribution, abnormal WT + MO1-net1 Fig. 2 from Wei et al., 2017
shield chrd expression decreased amount, abnormal WT + MO1-net1 Fig. 1,  Fig. 2 from Wei et al., 2017
shield GFP expression decreased amount, abnormal w25Tg + MO1-net1 Fig. 2 from Wei et al., 2017
shield dharma expression decreased amount, abnormal WT + MO1-net1 Fig. 2 from Wei et al., 2017
shield gsc expression decreased amount, abnormal WT + MO1-net1 Fig. 1 from Wei et al., 2017
Fig. 3 with image from Wei et al., 2017
shield gsc expression decreased distribution, abnormal WT + MO1-net1 Fig. 1 from Wei et al., 2017
shield GFP expression decreased distribution, abnormal w25Tg + MO1-net1 Fig. 2 from Wei et al., 2017
shield chrd expression decreased distribution, abnormal WT + MO1-net1 Fig. 1,  Fig. 2 from Wei et al., 2017
shield dharma expression decreased distribution, abnormal WT + MO1-net1 Fig. 2 from Wei et al., 2017
whole organism Ab15-ctnnb labeling decreased amount, abnormal WT + MO1-net1 Fig. 4,  Fig. 5 from Wei et al., 2017
whole organism gsc expression decreased amount, abnormal WT + MO1-net1 Fig. 1 from Wei et al., 2017
whole organism chrd expression decreased amount, abnormal WT + MO1-net1 Fig. 1 from Wei et al., 2017
whole organism dharma expression decreased amount, abnormal WT + MO1-net1 Fig. 1 from Wei et al., 2017
whole organism wholly ventralized, abnormal WT + MO1-net1 Fig. 1 from Wei et al., 2017
whole organism dorsal region chrd expression decreased amount, abnormal WT + MO1-net1 Fig. 1,  Fig. 3,  Fig. 4,  Fig. 5,  Fig. 7 from Wei et al., 2017
whole organism dorsal region dharma expression decreased amount, abnormal WT + MO1-net1 Fig. 1,  Fig. 3,  Fig. 4,  Fig. 5,  Fig. 7 from Wei et al., 2017
whole organism dorsal region dharma expression decreased distribution, abnormal WT + MO1-net1 Fig. 1,  Fig. 3,  Fig. 4,  Fig. 5,  Fig. 7 from Wei et al., 2017
whole organism dorsal region chrd expression decreased distribution, abnormal WT + MO1-net1 Fig. 1,  Fig. 3,  Fig. 4,  Fig. 5,  Fig. 7 from Wei et al., 2017
whole organism ventral region bmp2b expression increased distribution, abnormal WT + MO1-net1 Fig. 1 from Wei et al., 2017
Phenotype of all Fish created by or utilizing MO1-net1
Phenotype Fish Conditions Figures
presumptive endoderm ndr2 expression decreased amount, abnormal TU + MO1-net1 standard conditions Fig. 2 with image from Wei et al., 2017
endoderm sox32 expression decreased amount, abnormal TU + MO1-net1 standard conditions Fig. 1 with image from Wei et al., 2017
notochord shha expression decreased amount, abnormal TU + MO1-net1 standard conditions Fig. 1 with image from Wei et al., 2017
liver hhex expression decreased amount, abnormal TU + MO1-net1 standard conditions Fig. 1 with image from Wei et al., 2017
endoderm sox17 expression decreased amount, abnormal TU + MO1-net1 standard conditions Fig. 1 with image,  Fig. 3 with image from Wei et al., 2017
shield gsc expression decreased amount, abnormal TU + MO1-net1 standard conditions Fig. 3 with image from Wei et al., 2017
presumptive endoderm sox32 expression decreased amount, abnormal TU + MO1-net1 standard conditions Fig. 1 with image from Wei et al., 2017
endoderm foxa1 expression decreased amount, abnormal TU + MO1-net1 standard conditions Fig. 1 with image from Wei et al., 2017
pancreas primordium hhex expression decreased amount, abnormal TU + MO1-net1 standard conditions Fig. 1 with image from Wei et al., 2017
presumptive mesoderm gsc expression decreased amount, abnormal TU + MO1-net1 standard conditions Fig. 1 with image from Wei et al., 2017
notochord shha expression spatial pattern, abnormal TU + MO1-net1 standard conditions Fig. 1 with image from Wei et al., 2017
mesoderm gsc expression decreased amount, abnormal TU + MO1-net1 standard conditions Fig. 1 with image from Wei et al., 2017
notochord tbxta expression decreased amount, abnormal TU + MO1-net1 standard conditions Fig. 1 with image from Wei et al., 2017
pancreatic bud hhex expression decreased amount, abnormal TU + MO1-net1 standard conditions Fig. 1 with image from Wei et al., 2017
mesoderm tbxta expression decreased amount, abnormal TU + MO1-net1 standard conditions Fig. 1 with image from Wei et al., 2017
liver primordium hhex expression decreased amount, abnormal TU + MO1-net1 standard conditions Fig. 1 with image from Wei et al., 2017
pharyngeal pouch nkx2.3 expression decreased amount, abnormal TU + MO1-net1 standard conditions Fig. 1 with image from Wei et al., 2017
presumptive mesoderm tbxta expression decreased amount, abnormal TU + MO1-net1 standard conditions Fig. 1 with image from Wei et al., 2017
presumptive endoderm sox17 expression decreased amount, abnormal TU + MO1-net1 standard conditions Fig. 1 with image from Wei et al., 2017
presumptive endoderm fscn1a expression decreased amount, abnormal TU + MO1-net1 standard conditions Fig. 2 with image from Wei et al., 2017
notochord tbxta expression spatial pattern, abnormal TU + MO1-net1 standard conditions Fig. 1 with image from Wei et al., 2017
shield dharma expression decreased amount, abnormal WT + MO1-net1 standard conditions Fig. 2 from Wei et al., 2017
shield dharma expression decreased distribution, abnormal WT + MO1-net1 standard conditions Fig. 2 from Wei et al., 2017
presumptive mesoderm ventro-lateral region tbx6 expression decreased amount, abnormal WT + MO1-net1 standard conditions Fig. 2 from Wei et al., 2017
whole organism dorsal region chrd expression decreased amount, abnormal WT + MO1-net1 standard conditions Fig. 1,  Fig. 3,  Fig. 4,  Fig. 5,  Fig. 7 from Wei et al., 2017
shield chrd expression decreased distribution, abnormal WT + MO1-net1 standard conditions Fig. 1,  Fig. 2 from Wei et al., 2017
whole organism gsc expression decreased amount, abnormal WT + MO1-net1 standard conditions Fig. 1 from Wei et al., 2017
non neural ectoderm ventral region gata2a expression increased distribution, abnormal WT + MO1-net1 standard conditions Fig. 1 from Wei et al., 2017
neuroectoderm dorsal region sox3 expression decreased amount, abnormal WT + MO1-net1 standard conditions Fig. 1 from Wei et al., 2017
neuroectoderm dorsal region sox3 expression decreased distribution, abnormal WT + MO1-net1 standard conditions Fig. 1 from Wei et al., 2017
whole organism dharma expression decreased amount, abnormal WT + MO1-net1 standard conditions Fig. 1 from Wei et al., 2017
shield chrd expression decreased amount, abnormal WT + MO1-net1 standard conditions Fig. 1,  Fig. 2 from Wei et al., 2017
whole organism chrd expression decreased amount, abnormal WT + MO1-net1 standard conditions Fig. 1 from Wei et al., 2017
shield gsc expression decreased distribution, abnormal WT + MO1-net1 standard conditions Fig. 1 from Wei et al., 2017
presumptive mesoderm ventro-lateral region cdx4 expression decreased distribution, abnormal WT + MO1-net1 standard conditions Fig. 2 from Wei et al., 2017
dorsal/ventral axis specification decreased process quality, abnormal WT + MO1-net1 standard conditions Fig. 1 from Wei et al., 2017
shield gsc expression decreased amount, abnormal WT + MO1-net1 standard conditions Fig. 1 from Wei et al., 2017
whole organism ventral region bmp2b expression increased distribution, abnormal WT + MO1-net1 standard conditions Fig. 1 from Wei et al., 2017
presumptive mesoderm ventro-lateral region cdx4 expression decreased amount, abnormal WT + MO1-net1 standard conditions Fig. 2 from Wei et al., 2017
presumptive mesoderm ventro-lateral region tbx6 expression decreased distribution, abnormal WT + MO1-net1 standard conditions Fig. 2 from Wei et al., 2017
whole organism dorsal region chrd expression decreased distribution, abnormal WT + MO1-net1 standard conditions Fig. 1,  Fig. 3,  Fig. 4,  Fig. 5,  Fig. 7 from Wei et al., 2017
whole organism wholly ventralized, abnormal WT + MO1-net1 standard conditions Fig. 1 from Wei et al., 2017
whole organism dorsal region dharma expression decreased amount, abnormal WT + MO1-net1 standard conditions Fig. 1,  Fig. 3,  Fig. 4,  Fig. 5,  Fig. 7 from Wei et al., 2017
whole organism dorsal region dharma expression decreased distribution, abnormal WT + MO1-net1 standard conditions Fig. 1,  Fig. 3,  Fig. 4,  Fig. 5,  Fig. 7 from Wei et al., 2017
whole organism Ab15-ctnnb labeling decreased amount, abnormal WT + MO1-net1 standard conditions Fig. 4,  Fig. 5 from Wei et al., 2017
presumptive mesoderm ventro-lateral region GFP expression decreased amount, abnormal w25Tg + MO1-net1 standard conditions Fig. 2 from Wei et al., 2017
shield GFP expression decreased amount, abnormal w25Tg + MO1-net1 standard conditions Fig. 2 from Wei et al., 2017
shield GFP expression decreased distribution, abnormal w25Tg + MO1-net1 standard conditions Fig. 2 from Wei et al., 2017
presumptive mesoderm ventro-lateral region GFP expression decreased distribution, abnormal w25Tg + MO1-net1 standard conditions Fig. 2 from Wei et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.