Morpholino

MO3-setb

ID
ZDB-MRPHLNO-170223-2
Name
MO3-setb
Previous Names
  • E3I3 (1)
Target
Sequence
5' - TGAGTTATATTCCCTCTCACCTTGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-setb
No data available
Phenotype
Phenotype resulting from MO3-setb
Phenotype Fish Figures
brain mCherry expression decreased amount, abnormal ia10Tg + MO3-setb Figure 2 with image from Serifi et al., 2021
eye decreased size, abnormal WT + MO3-setb Fig. 5 from Serifi et al., 2016
eye deformed, abnormal WT + MO3-setb Fig. 5 from Serifi et al., 2016
floor plate mCherry expression decreased amount, abnormal ia10Tg + MO3-setb Figure 2 with image from Serifi et al., 2021
head Ab1-set labeling decreased distribution, abnormal WT + MO3-setb Fig. 5 from Serifi et al., 2016
head decreased size, abnormal WT + MO3-setb Fig. 5 from Serifi et al., 2016
head shape, abnormal WT + MO3-setb Fig. 5 from Serifi et al., 2016
lateral line system development disrupted, abnormal WT + MO3-setb Fig. 7 from Serifi et al., 2016
muscle pioneer mCherry expression decreased amount, abnormal ia10Tg + MO3-setb Figure 2 with image from Serifi et al., 2021
myotome medial region mCherry expression decreased amount, abnormal ia10Tg + MO3-setb Figure 2 with image from Serifi et al., 2021
myotome smoothened signaling pathway decreased process quality, abnormal ia10Tg + MO3-setb Figure 2 with image from Serifi et al., 2021
myotome development decreased process quality, abnormal ia10Tg + MO3-setb Figure 2 with image from Serifi et al., 2021
neuromast decreased amount, abnormal WT + MO3-setb Fig. 7 from Serifi et al., 2016
post-vent region curved, abnormal WT + MO3-setb Fig. 5 from Serifi et al., 2016
post-vent region Ab1-set labeling decreased distribution, abnormal WT + MO3-setb Fig. 5 from Serifi et al., 2016
trunk bent, abnormal WT + MO3-setb Fig. 5 from Serifi et al., 2016
trunk Ab1-set labeling decreased distribution, abnormal WT + MO3-setb Fig. 5 from Serifi et al., 2016
trunk slow muscle cell mCherry expression decreased amount, abnormal ia10Tg + MO3-setb Figure 2 with image from Serifi et al., 2021
whole organism otpb expression decreased amount, abnormal WT + MO3-setb Fig. 8 from Serifi et al., 2016
whole organism neurod4 expression decreased amount, abnormal WT + MO3-setb Fig. 8 from Serifi et al., 2016
whole organism Ab2-set labeling decreased amount, abnormal WT + MO3-setb Fig. 5 from Serifi et al., 2016
whole organism neurod1 expression decreased amount, abnormal WT + MO3-setb Fig. 8 from Serifi et al., 2016
whole organism atoh7 expression decreased amount, abnormal WT + MO3-setb Fig. 8 from Serifi et al., 2016
whole organism six7 expression decreased amount, abnormal WT + MO3-setb Fig. 8 from Serifi et al., 2016
whole organism crx expression decreased amount, abnormal WT + MO3-setb Fig. 8 from Serifi et al., 2016
whole organism akt3b expression decreased amount, abnormal WT + MO3-setb Fig. 8 from Serifi et al., 2016
whole organism otpa expression decreased amount, abnormal WT + MO3-setb Fig. 8 from Serifi et al., 2016
whole organism oc90 expression increased amount, abnormal WT + MO3-setb Fig. 8 from Serifi et al., 2016
whole organism atoh1a expression increased amount, abnormal WT + MO3-setb Fig. 8 from Serifi et al., 2016
whole organism junba expression increased amount, abnormal WT + MO3-setb Fig. 8 from Serifi et al., 2016
whole organism foxj1a expression increased amount, abnormal WT + MO3-setb Fig. 8 from Serifi et al., 2016
whole organism cdkn1a expression increased amount, abnormal WT + MO3-setb Fig. 8 from Serifi et al., 2016
whole organism anterior-posterior axis decreased length, abnormal WT + MO3-setb Fig. 5 from Serifi et al., 2016
Phenotype of all Fish created by or utilizing MO3-setb
Phenotype Fish Conditions Figures
post-vent region curved, abnormal WT + MO3-setb standard conditions Fig. 5 from Serifi et al., 2016
whole organism foxj1a expression increased amount, abnormal WT + MO3-setb standard conditions Fig. 8 from Serifi et al., 2016
trunk bent, abnormal WT + MO3-setb standard conditions Fig. 5 from Serifi et al., 2016
whole organism six7 expression decreased amount, abnormal WT + MO3-setb standard conditions Fig. 8 from Serifi et al., 2016
whole organism crx expression decreased amount, abnormal WT + MO3-setb standard conditions Fig. 8 from Serifi et al., 2016
head shape, abnormal WT + MO3-setb standard conditions Fig. 5 from Serifi et al., 2016
trunk Ab1-set labeling decreased distribution, abnormal WT + MO3-setb standard conditions Fig. 5 from Serifi et al., 2016
eye deformed, abnormal WT + MO3-setb standard conditions Fig. 5 from Serifi et al., 2016
whole organism Ab2-set labeling decreased amount, abnormal WT + MO3-setb standard conditions Fig. 5 from Serifi et al., 2016
whole organism oc90 expression increased amount, abnormal WT + MO3-setb standard conditions Fig. 8 from Serifi et al., 2016
head Ab1-set labeling decreased distribution, abnormal WT + MO3-setb standard conditions Fig. 5 from Serifi et al., 2016
whole organism cdkn1a expression increased amount, abnormal WT + MO3-setb standard conditions Fig. 8 from Serifi et al., 2016
whole organism junba expression increased amount, abnormal WT + MO3-setb standard conditions Fig. 8 from Serifi et al., 2016
whole organism anterior-posterior axis decreased length, abnormal WT + MO3-setb standard conditions Fig. 5 from Serifi et al., 2016
whole organism neurod1 expression decreased amount, abnormal WT + MO3-setb standard conditions Fig. 8 from Serifi et al., 2016
lateral line system development disrupted, abnormal WT + MO3-setb standard conditions Fig. 7 from Serifi et al., 2016
whole organism otpb expression decreased amount, abnormal WT + MO3-setb standard conditions Fig. 8 from Serifi et al., 2016
whole organism otpa expression decreased amount, abnormal WT + MO3-setb standard conditions Fig. 8 from Serifi et al., 2016
post-vent region Ab1-set labeling decreased distribution, abnormal WT + MO3-setb standard conditions Fig. 5 from Serifi et al., 2016
whole organism atoh7 expression decreased amount, abnormal WT + MO3-setb standard conditions Fig. 8 from Serifi et al., 2016
head decreased size, abnormal WT + MO3-setb standard conditions Fig. 5 from Serifi et al., 2016
eye decreased size, abnormal WT + MO3-setb standard conditions Fig. 5 from Serifi et al., 2016
whole organism akt3b expression decreased amount, abnormal WT + MO3-setb standard conditions Fig. 8 from Serifi et al., 2016
neuromast decreased amount, abnormal WT + MO3-setb standard conditions Fig. 7 from Serifi et al., 2016
whole organism atoh1a expression increased amount, abnormal WT + MO3-setb standard conditions Fig. 8 from Serifi et al., 2016
whole organism neurod4 expression decreased amount, abnormal WT + MO3-setb standard conditions Fig. 8 from Serifi et al., 2016
floor plate mCherry expression decreased amount, abnormal ia10Tg + MO3-setb standard conditions Figure 2 with image from Serifi et al., 2021
brain mCherry expression decreased amount, abnormal ia10Tg + MO3-setb standard conditions Figure 2 with image from Serifi et al., 2021
muscle pioneer mCherry expression decreased amount, abnormal ia10Tg + MO3-setb standard conditions Figure 2 with image from Serifi et al., 2021
myotome medial region mCherry expression decreased amount, abnormal ia10Tg + MO3-setb standard conditions Figure 2 with image from Serifi et al., 2021
myotome smoothened signaling pathway decreased process quality, abnormal ia10Tg + MO3-setb standard conditions Figure 2 with image from Serifi et al., 2021
myotome development decreased process quality, abnormal ia10Tg + MO3-setb standard conditions Figure 2 with image from Serifi et al., 2021
trunk slow muscle cell mCherry expression decreased amount, abnormal ia10Tg + MO3-setb standard conditions Figure 2 with image from Serifi et al., 2021
Citations