Morpholino

MO2-add3a

ID
ZDB-MRPHLNO-161221-5
Name
MO2-add3a
Previous Names
None
Target
Sequence
5' - TCCTGTCTCGGCTCGCCACTCATCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-add3a
No data available
Phenotype
Phenotype resulting from MO2-add3a
Phenotype of all Fish created by or utilizing MO2-add3a
Phenotype Fish Conditions Figures
intrahepatic bile duct sparse, abnormal AB + MO2-add3a control FIGURE 4 with image from Han et al., 2026
liver A2-type glycerophospholipase activity decreased process quality, abnormal AB + MO2-add3a control FIGURE 4 with image from Han et al., 2026
liver morphogenesis decreased occurrence, abnormal TL + MO2-add3a + MO3-add3a standard conditions Fig. 2 with image from Tang et al., 2016
hepaticobiliary system development decreased occurrence, abnormal TL + MO2-add3a + MO3-add3a standard conditions Fig. 2 with imageFig. 3 with image from Tang et al., 2016
liver morphology, ameliorated TL + MO2-add3a + MO3-add3a chemical treatment by environment: Cyclopamine Fig. 3 with image from Tang et al., 2016
liver functionality, ameliorated TL + MO2-add3a + MO3-add3a chemical treatment by environment: Cyclopamine Fig. 3 with image from Tang et al., 2016
hepaticobiliary system development occurrence, ameliorated TL + MO2-add3a + MO3-add3a chemical treatment by environment: Cyclopamine Fig. 3 with image from Tang et al., 2016
liver has fewer parts of type intrahepatic bile duct, abnormal TL + MO2-add3a + MO3-add3a standard conditions Fig. 2 with imageFig. 3 with image from Tang et al., 2016
intrahepatic bile duct decreased length, abnormal TL + MO2-add3a + MO3-add3a standard conditions Fig. 2 with imageFig. 3 with image from Tang et al., 2016
liver has number of intrahepatic bile duct, ameliorated TL + MO2-add3a + MO3-add3a chemical treatment by environment: Cyclopamine Fig. 3 with image from Tang et al., 2016
whole organism ptch1 expression increased amount, abnormal TL + MO2-add3a + MO3-add3a standard conditions Fig. 3 with image from Tang et al., 2016
whole organism ccnd1 expression increased amount, abnormal TL + MO2-add3a + MO3-add3a standard conditions Fig. 3 with image from Tang et al., 2016
liver malformed, abnormal TL + MO2-add3a + MO3-add3a standard conditions Fig. 2 with imageFig. 3 with image from Tang et al., 2016
whole organism gli2a expression increased amount, abnormal TL + MO2-add3a + MO3-add3a standard conditions Fig. 3 with image from Tang et al., 2016
liver decreased functionality, abnormal TL + MO2-add3a + MO3-add3a standard conditions Fig. 3 with image from Tang et al., 2016
intrahepatic bile duct length, ameliorated TL + MO2-add3a + MO3-add3a chemical treatment by environment: Cyclopamine Fig. 3 with image from Tang et al., 2016
liver decreased functionality, exacerbated TL + MO1-gpc1a + MO2-add3a + MO2-gpc1a + MO3-add3a standard conditions Fig. 4 with image from Tang et al., 2016
intrahepatic bile duct decreased length, exacerbated TL + MO1-gpc1a + MO2-add3a + MO2-gpc1a + MO3-add3a standard conditions Fig. 4 with image from Tang et al., 2016
liver has fewer parts of type intrahepatic bile duct, exacerbated TL + MO1-gpc1a + MO2-add3a + MO2-gpc1a + MO3-add3a standard conditions Fig. 4 with image from Tang et al., 2016
hepaticobiliary system development decreased occurrence, exacerbated TL + MO1-gpc1a + MO2-add3a + MO2-gpc1a + MO3-add3a standard conditions Fig. 4 with image from Tang et al., 2016
Citations