Morpholino

MO6-mecom

ID
ZDB-MRPHLNO-161213-2
Name
MO6-mecom
Previous Names
None
Target
Sequence
5' - TGAAGGGTCTGAGTGACTTACATAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO6-mecom
No data available
Phenotype
Phenotype resulting from MO6-mecom
No data available
Phenotype of all Fish created by or utilizing MO6-mecom
Phenotype Fish Conditions Figures
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell decreased amount, abnormal TU + MO5-mecom + MO6-mecom standard conditions Fig. 1 from Konantz et al., 2016
hematopoietic multipotent progenitor cell runx1 expression decreased amount, abnormal TU + MO5-mecom + MO6-mecom standard conditions Fig. 1Fig. 4 from Konantz et al., 2016
thymus T cell rag1 expression decreased amount, abnormal TU + MO5-mecom + MO6-mecom standard conditions Fig. 1 from Konantz et al., 2016
ventral wall of dorsal aorta dll4 expression decreased amount, abnormal TU + MO5-mecom + MO6-mecom standard conditions Fig. 6 from Konantz et al., 2016
ventral wall of dorsal aorta monocyte decreased amount, abnormal TU + MO5-mecom + MO6-mecom standard conditions Fig. 1 from Konantz et al., 2016
nucleate erythrocyte hbae3 expression decreased amount, abnormal TU + MO5-mecom + MO6-mecom standard conditions Fig. 1 from Konantz et al., 2016
neutrophil mpx expression decreased amount, abnormal TU + MO5-mecom + MO6-mecom standard conditions Fig. 1 from Konantz et al., 2016
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell runx1 expression decreased amount, abnormal TU + MO5-mecom + MO6-mecom standard conditions Fig. 7 from Konantz et al., 2016
ventral wall of dorsal aorta notch1b expression decreased amount, abnormal TU + MO5-mecom + MO6-mecom standard conditions Fig. 6Fig. 7 from Konantz et al., 2016
ventral wall of dorsal aorta itga2b expression decreased amount, abnormal TU + MO5-mecom + MO6-mecom standard conditions Fig. 1 from Konantz et al., 2016
thymus T cell decreased amount, abnormal TU + MO5-mecom + MO6-mecom standard conditions Fig. 1 from Konantz et al., 2016
ventral wall of dorsal aorta gata2a expression decreased amount, abnormal TU + MO5-mecom + MO6-mecom standard conditions Fig. 1 from Konantz et al., 2016
ventral wall of dorsal aorta neutrophil decreased amount, abnormal TU + MO5-mecom + MO6-mecom standard conditions Fig. 1 from Konantz et al., 2016
hematopoietic multipotent progenitor cell myb expression decreased amount, abnormal TU + MO5-mecom + MO6-mecom standard conditions Fig. 1Fig. 4 from Konantz et al., 2016
ventral wall of dorsal aorta nucleate erythrocyte decreased amount, abnormal TU + MO5-mecom + MO6-mecom standard conditions Fig. 1 from Konantz et al., 2016
monocyte lcp1 expression decreased amount, abnormal TU + MO5-mecom + MO6-mecom standard conditions Fig. 1 from Konantz et al., 2016
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell myb expression decreased amount, abnormal TU + MO5-mecom + MO6-mecom standard conditions Fig. 7 from Konantz et al., 2016
hematopoietic multipotent progenitor cell runx1 expression amount, ameliorated nc2aTg + MO5-mecom + MO6-mecom heat shock Fig. 4 from Konantz et al., 2016
ventral wall of dorsal aorta dll4 expression amount, ameliorated nc2aTg + MO5-mecom + MO6-mecom heat shock Fig. 6 from Konantz et al., 2016
hematopoietic multipotent progenitor cell myb expression amount, ameliorated nc2aTg + MO5-mecom + MO6-mecom heat shock Fig. 4 from Konantz et al., 2016
ventral wall of dorsal aorta notch1b expression amount, ameliorated nc2aTg + MO5-mecom + MO6-mecom heat shock Fig. 6 from Konantz et al., 2016
hematopoietic multipotent progenitor cell runx1 expression amount, ameliorated kca3Tg; kca4Tg + MO5-mecom + MO6-mecom heat shock Fig. 4 from Konantz et al., 2016
hematopoietic multipotent progenitor cell myb expression amount, ameliorated kca3Tg; kca4Tg + MO5-mecom + MO6-mecom heat shock Fig. 4 from Konantz et al., 2016
endothelial to hematopoietic transition occurrence, ameliorated kca3Tg; nkuasrfp1aTg; ubs3Tg; zf169Tg + MO5-mecom + MO6-mecom standard conditions Fig. 5 from Konantz et al., 2016
hematopoietic multipotent progenitor cell runx1 expression amount, ameliorated mu101Tg ; kca3Tg + MO5-mecom + MO6-mecom heat shock Fig. 4 from Konantz et al., 2016
hematopoietic multipotent progenitor cell myb expression amount, ameliorated mu101Tg ; kca3Tg + MO5-mecom + MO6-mecom heat shock Fig. 4 from Konantz et al., 2016
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell myb expression amount, ameliorated nkuasrfp1aTg; ubs3Tg + MO5-mecom + MO6-mecom standard conditions Fig. 7 from Konantz et al., 2016
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell runx1 expression amount, ameliorated nkuasrfp1aTg; ubs3Tg + MO5-mecom + MO6-mecom standard conditions Fig. 7 from Konantz et al., 2016
ventral wall of dorsal aorta notch1b expression amount, ameliorated nkuasrfp1aTg; ubs3Tg + MO5-mecom + MO6-mecom standard conditions Fig. 7 from Konantz et al., 2016
endothelial to hematopoietic transition decreased occurrence, abnormal nkuasrfp1aTg; ubs3Tg; zf169Tg + MO5-mecom + MO6-mecom standard conditions Fig. 5 from Konantz et al., 2016
angioblastic mesenchymal cell myb expression decreased amount, abnormal zf169Tg ; ubs16Tg + MO5-mecom + MO6-mecom standard conditions Fig. 3 from Konantz et al., 2016
angioblastic mesenchymal cell flt1 expression increased amount, abnormal zf169Tg ; ubs16Tg + MO5-mecom + MO6-mecom standard conditions Fig. 3 from Konantz et al., 2016
angioblastic mesenchymal cell kdrl expression increased amount, abnormal zf169Tg ; ubs16Tg + MO5-mecom + MO6-mecom standard conditions Fig. 3 from Konantz et al., 2016
angioblastic mesenchymal cell dab2 expression increased amount, abnormal zf169Tg ; ubs16Tg + MO5-mecom + MO6-mecom standard conditions Fig. 3 from Konantz et al., 2016
angioblastic mesenchymal cell ptprc expression decreased amount, abnormal zf169Tg ; ubs16Tg + MO5-mecom + MO6-mecom standard conditions Fig. 3 from Konantz et al., 2016
angioblastic mesenchymal cell runx1 expression decreased amount, abnormal zf169Tg ; ubs16Tg + MO5-mecom + MO6-mecom standard conditions Fig. 3 from Konantz et al., 2016
angioblastic mesenchymal cell itga2b expression decreased amount, abnormal zf169Tg ; ubs16Tg + MO5-mecom + MO6-mecom standard conditions Fig. 3 from Konantz et al., 2016
endothelial to hematopoietic transition decreased occurrence, abnormal zf169Tg ; ubs16Tg + MO5-mecom + MO6-mecom standard conditions Fig. 3 from Konantz et al., 2016
angioblastic mesenchymal cell cdh5 expression increased amount, abnormal zf169Tg ; ubs16Tg + MO5-mecom + MO6-mecom standard conditions Fig. 3 from Konantz et al., 2016
dorsal aorta vascular endothelium notch1b expression decreased amount, abnormal slc45a2b4/b4 + MO5-mecom + MO6-mecom standard conditions Fig. 2 from Konantz et al., 2016
dorsal aorta vascular endothelium dll4 expression decreased amount, abnormal slc45a2b4/b4 + MO5-mecom + MO6-mecom standard conditions Fig. 2 from Konantz et al., 2016
Citations