Morpholino

MO1-tgfbr2b

ID
ZDB-MRPHLNO-161101-2
Name
MO1-tgfbr2b
Previous Names
None
Target
Sequence
5' - ATATCGCTCCATTAGAAACGCAGTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tgfbr2b
Expressed Gene Anatomy Figures
baxa Fig. 5 with image from Monteiro et al., 2016
cdkn1a Fig. 5 with image from Monteiro et al., 2016
efnb2a Fig. 2 with image from Monteiro et al., 2016
gata2b Fig. 2 with image from Monteiro et al., 2016
gfi1aa Fig. 2 with image from Monteiro et al., 2016
hbbe1.1 Fig. 2 with image from Monteiro et al., 2016
hey2 Fig. 2 with image from Monteiro et al., 2016
jag1a Fig. 5 with image from Monteiro et al., 2016
kdrl Fig. 2 with image from Monteiro et al., 2016
myb Fig. 6 with image from Monteiro et al., 2016
notch3 Fig. 2 with image from Monteiro et al., 2016
rag1 Fig. 2 with image from Monteiro et al., 2016
runx1 Fig. 2 with image,  Fig. 6 with image from Monteiro et al., 2016
tp53 Fig. 5 with image from Monteiro et al., 2016
Phenotype
Phenotype resulting from MO1-tgfbr2b
Phenotype Fish Figures
caudal vein plexus apoptotic process increased occurrence, abnormal s843Tg + MO1-tgfbr2b Fig. 5 with image from Monteiro et al., 2016
erythroid lineage cell hbbe1.1 expression decreased amount, abnormal WT + MO1-tgfbr2b Fig. 2 with image from Monteiro et al., 2016
hematopoietic multipotent progenitor cell decreased amount, abnormal la2Tg; s843Tg + MO1-tgfbr2b Fig. 2 with image from Monteiro et al., 2016
intermediate cell mass of mesoderm hematopoietic multipotent progenitor cell decreased amount, abnormal la2Tg; s843Tg + MO1-tgfbr2b Fig. 2 with image from Monteiro et al., 2016
thymus T cell rag1 expression absent, abnormal WT + MO1-tgfbr2b Fig. 2 with image from Monteiro et al., 2016
trunk jag1a expression decreased amount, abnormal s843Tg + MO1-tgfbr2b Fig. 5 with image from Monteiro et al., 2016
trunk baxa expression increased amount, abnormal s843Tg + MO1-tgfbr2b Fig. 5 with image from Monteiro et al., 2016
trunk cdkn1a expression increased amount, abnormal s843Tg + MO1-tgfbr2b Fig. 5 with image from Monteiro et al., 2016
trunk tp53 expression increased amount, abnormal s843Tg + MO1-tgfbr2b Fig. 5 with image from Monteiro et al., 2016
trunk endothelial cell jag1a expression decreased amount, abnormal s843Tg + MO1-tgfbr2b Fig. 5 with image from Monteiro et al., 2016
trunk endothelial cell cdkn1a expression increased amount, abnormal s843Tg + MO1-tgfbr2b Fig. 5 with image from Monteiro et al., 2016
trunk endothelial cell tp53 expression increased amount, abnormal s843Tg + MO1-tgfbr2b Fig. 5 with image from Monteiro et al., 2016
ventral wall of dorsal aorta gata2b expression decreased amount, abnormal WT + MO1-tgfbr2b Fig. 2 with image from Monteiro et al., 2016
ventral wall of dorsal aorta myb expression decreased amount, abnormal WT + MO1-tgfbr2b Fig. 6 with image from Monteiro et al., 2016
ventral wall of dorsal aorta gfi1aa expression decreased amount, abnormal WT + MO1-tgfbr2b Fig. 2 with image from Monteiro et al., 2016
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal WT + MO1-tgfbr2b Fig. 2 with image,  Fig. 6 with image from Monteiro et al., 2016
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell decreased amount, abnormal la2Tg; s843Tg + MO1-tgfbr2b Fig. 2 with image from Monteiro et al., 2016
Phenotype of all Fish created by or utilizing MO1-tgfbr2b
Phenotype Fish Conditions Figures
thymus T cell rag1 expression absent, abnormal WT + MO1-tgfbr2b standard conditions Fig. 2 with image from Monteiro et al., 2016
ventral wall of dorsal aorta gfi1aa expression decreased amount, abnormal WT + MO1-tgfbr2b standard conditions Fig. 2 with image from Monteiro et al., 2016
ventral wall of dorsal aorta gata2b expression decreased amount, abnormal WT + MO1-tgfbr2b standard conditions Fig. 2 with image from Monteiro et al., 2016
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal WT + MO1-tgfbr2b standard conditions Fig. 2 with image,  Fig. 6 with image from Monteiro et al., 2016
erythroid lineage cell hbbe1.1 expression decreased amount, abnormal WT + MO1-tgfbr2b standard conditions Fig. 2 with image from Monteiro et al., 2016
ventral wall of dorsal aorta myb expression decreased amount, abnormal WT + MO1-tgfbr2b standard conditions Fig. 6 with image from Monteiro et al., 2016
trunk endothelial cell cdkn1a expression increased amount, abnormal s843Tg + MO1-tgfbr2b standard conditions Fig. 5 with image from Monteiro et al., 2016
trunk cdkn1a expression increased amount, abnormal s843Tg + MO1-tgfbr2b standard conditions Fig. 5 with image from Monteiro et al., 2016
trunk baxa expression increased amount, abnormal s843Tg + MO1-tgfbr2b standard conditions Fig. 5 with image from Monteiro et al., 2016
trunk endothelial cell tp53 expression increased amount, abnormal s843Tg + MO1-tgfbr2b standard conditions Fig. 5 with image from Monteiro et al., 2016
trunk jag1a expression decreased amount, abnormal s843Tg + MO1-tgfbr2b standard conditions Fig. 5 with image from Monteiro et al., 2016
trunk endothelial cell jag1a expression decreased amount, abnormal s843Tg + MO1-tgfbr2b standard conditions Fig. 5 with image from Monteiro et al., 2016
trunk tp53 expression increased amount, abnormal s843Tg + MO1-tgfbr2b standard conditions Fig. 5 with image from Monteiro et al., 2016
caudal vein plexus apoptotic process increased occurrence, abnormal s843Tg + MO1-tgfbr2b standard conditions Fig. 5 with image from Monteiro et al., 2016
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell decreased amount, abnormal la2Tg; s843Tg + MO1-tgfbr2b standard conditions Fig. 2 with image from Monteiro et al., 2016
hematopoietic multipotent progenitor cell decreased amount, abnormal la2Tg; s843Tg + MO1-tgfbr2b standard conditions Fig. 2 with image from Monteiro et al., 2016
intermediate cell mass of mesoderm hematopoietic multipotent progenitor cell decreased amount, abnormal la2Tg; s843Tg + MO1-tgfbr2b standard conditions Fig. 2 with image from Monteiro et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.