Morpholino
MO1-glula
- ID
- ZDB-MRPHLNO-161017-1
- Name
- MO1-glula
- Previous Names
- None
- Target
- Sequence
-
5' - ATAGTTCAAGTCCAGCTTACCTTCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-glula
No data available
Phenotype
Phenotype resulting from MO1-glula
1 - 5 of 6 Show all
Phenotype of all Fish created by or utilizing MO1-glula
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| whole organism viability, abnormal | AB + MO1-glula | control |
Figure 2 
from Zhao et al., 2024 |
| otolith fused with otolith, abnormal | s356tTg + MO1-glula (AB) | control |
Figure 2
from Zhao et al., 2024 |
| otic vesicle hair cell decreased amount, abnormal | s356tTg + MO1-glula (AB) | control |
Figure 2
from Zhao et al., 2024 |
| otolith amount, abnormal | s356tTg + MO1-glula (AB) | control |
Figure 2
from Zhao et al., 2024 |
| otolith spatial pattern, abnormal | s356tTg + MO1-glula (AB) | control |
Figure 2
from Zhao et al., 2024 |
1 - 5 of 7 Show all
Citations
- Zhao, Y., Wang, Z., Xu, M., Qian, F., Wei, G., Liu, D. (2024) The Glutamine Synthetases Are Required for Sensory Hair Cell Formation and Auditory Function in Zebrafish. International Journal of Molecular Sciences. 25(21):
- Cox, A.G., Hwang, K.L., Brown, K.K., Evason, K.J., Beltz, S., Tsomides, A., O'Connor, K., Galli, G.G., Yimlamai, D., Chhangawala, S., Yuan, M., Lien, E.C., Wucherpfennig, J., Nissim, S., Minami, A., Cohen, D.E., Camargo, F.D., Asara, J.M., Houvras, Y., Stainier, D.Y., Goessling, W. (2016) Yap reprograms glutamine metabolism to increase nucleotide biosynthesis and enable liver growth. Nature cell biology. 18(8):886-96
1 - 2 of 2
Show