Morpholino

MO3-fbxo32

ID
ZDB-MRPHLNO-160408-1
Name
MO3-fbxo32
Previous Names
None
Target
Sequence
5' - GTCTTGTCCAAGAAACGGCATTGTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-fbxo32
No data available
Phenotype
Phenotype resulting from MO3-fbxo32
Phenotype Fish Figures
autophagy disrupted, abnormal WT + MO3-fbxo32 Fig. 5 with image from Bühler et al., 2016
cardiac muscle cell mitochondrion morphology, abnormal WT + MO3-fbxo32 Fig. 6 with image from Bühler et al., 2016
cardiac muscle cell sarcomere decreased amount, abnormal WT + MO3-fbxo32 Fig. 6 with image from Bühler et al., 2016
heart decreased functionality, abnormal WT + MO3-fbxo32 Fig. 4 with image from Bühler et al., 2016
heart morphology, abnormal WT + MO3-fbxo32 Fig. 2 with image from Bühler et al., 2016
heart contraction decreased efficacy, abnormal WT + MO3-fbxo32 Fig. 4 with image from Bühler et al., 2016
heart contraction decreased rate, abnormal WT + MO3-fbxo32 Fig. 4 with image from Bühler et al., 2016
locomotion involved in locomotory behavior disrupted, abnormal WT + MO3-fbxo32 Fig. 3 with image from Bühler et al., 2016
pericardium edematous, abnormal WT + MO3-fbxo32 Fig. 2 with image from Bühler et al., 2016
skeletal muscle disorganized, abnormal WT + MO3-fbxo32 Fig. 3 with image from Bühler et al., 2016
skeletal muscle morphology, abnormal WT + MO3-fbxo32 Fig. 2 with image from Bühler et al., 2016
skeletal muscle refractivity, abnormal WT + MO3-fbxo32 Fig. 3 with imageFig. S1 with image from Bühler et al., 2016
skeletal muscle vacuolated, abnormal WT + MO3-fbxo32 Fig. 3 with image from Bühler et al., 2016
skeletal muscle mitochondrial crista decreased amount, abnormal WT + MO3-fbxo32 Fig. 6 with image from Bühler et al., 2016
skeletal muscle mitochondrion morphology, abnormal WT + MO3-fbxo32 Fig. 6 with image from Bühler et al., 2016
skeletal muscle myofilament disorganized, abnormal WT + MO3-fbxo32 Fig. 3 with imageFig. 6 with image from Bühler et al., 2016
thigmotaxis disrupted, abnormal WT + MO3-fbxo32 Fig. 3 with image from Bühler et al., 2016
whole organism decreased mobility, abnormal WT + MO3-fbxo32 Fig. 3 with image from Bühler et al., 2016
Phenotype of all Fish created by or utilizing MO3-fbxo32
Phenotype Fish Conditions Figures
skeletal muscle myofilament disorganized, abnormal WT + MO3-fbxo32 standard conditions Fig. 3 with imageFig. 6 with image from Bühler et al., 2016
cardiac muscle cell sarcomere decreased amount, abnormal WT + MO3-fbxo32 standard conditions Fig. 6 with image from Bühler et al., 2016
thigmotaxis disrupted, abnormal WT + MO3-fbxo32 standard conditions Fig. 3 with image from Bühler et al., 2016
skeletal muscle vacuolated, abnormal WT + MO3-fbxo32 standard conditions Fig. 3 with image from Bühler et al., 2016
heart morphology, abnormal WT + MO3-fbxo32 standard conditions Fig. 2 with image from Bühler et al., 2016
heart contraction decreased rate, abnormal WT + MO3-fbxo32 standard conditions Fig. 4 with image from Bühler et al., 2016
cardiac muscle cell mitochondrion morphology, abnormal WT + MO3-fbxo32 standard conditions Fig. 6 with image from Bühler et al., 2016
skeletal muscle morphology, abnormal WT + MO3-fbxo32 standard conditions Fig. 2 with image from Bühler et al., 2016
heart decreased functionality, abnormal WT + MO3-fbxo32 standard conditions Fig. 4 with image from Bühler et al., 2016
skeletal muscle mitochondrial crista decreased amount, abnormal WT + MO3-fbxo32 standard conditions Fig. 6 with image from Bühler et al., 2016
heart contraction decreased efficacy, abnormal WT + MO3-fbxo32 standard conditions Fig. 4 with image from Bühler et al., 2016
skeletal muscle mitochondrion morphology, abnormal WT + MO3-fbxo32 standard conditions Fig. 6 with image from Bühler et al., 2016
skeletal muscle refractivity, abnormal WT + MO3-fbxo32 standard conditions Fig. 3 with imageFig. S1 with image from Bühler et al., 2016
pericardium edematous, abnormal WT + MO3-fbxo32 standard conditions Fig. 2 with image from Bühler et al., 2016
autophagy disrupted, abnormal WT + MO3-fbxo32 standard conditions Fig. 5 with image from Bühler et al., 2016
whole organism decreased mobility, abnormal WT + MO3-fbxo32 standard conditions Fig. 3 with image from Bühler et al., 2016
locomotion involved in locomotory behavior disrupted, abnormal WT + MO3-fbxo32 standard conditions Fig. 3 with image from Bühler et al., 2016
skeletal muscle disorganized, abnormal WT + MO3-fbxo32 standard conditions Fig. 3 with image from Bühler et al., 2016
Citations