Morpholino

MO3-fbxo32

ID
ZDB-MRPHLNO-160408-1
Name
MO3-fbxo32
Previous Names
None
Target
Sequence
5' - GTCTTGTCCAAGAAACGGCATTGTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-fbxo32
Expressed Gene Anatomy Figures
myh6 Fig. 4 with image from Bühler et al., 2016
myh7 Fig. 4 with image from Bühler et al., 2016
myod1 Fig. 3 with image from Bühler et al., 2016
myog Fig. 3 with image from Bühler et al., 2016
Phenotype
Phenotype resulting from MO3-fbxo32
Phenotype Fish Figures
autophagy disrupted, abnormal WT + MO3-fbxo32 Fig. 5 with image from Bühler et al., 2016
cardiac muscle cell mitochondrion morphology, abnormal WT + MO3-fbxo32 Fig. 6 with image from Bühler et al., 2016
cardiac muscle cell sarcomere decreased amount, abnormal WT + MO3-fbxo32 Fig. 6 with image from Bühler et al., 2016
heart decreased functionality, abnormal WT + MO3-fbxo32 Fig. 4 with image from Bühler et al., 2016
heart morphology, abnormal WT + MO3-fbxo32 Fig. 2 with image from Bühler et al., 2016
heart contraction decreased efficacy, abnormal WT + MO3-fbxo32 Fig. 4 with image from Bühler et al., 2016
heart contraction decreased rate, abnormal WT + MO3-fbxo32 Fig. 4 with image from Bühler et al., 2016
locomotion involved in locomotory behavior disrupted, abnormal WT + MO3-fbxo32 Fig. 3 with image from Bühler et al., 2016
pericardium edematous, abnormal WT + MO3-fbxo32 Fig. 2 with image from Bühler et al., 2016
skeletal muscle disorganized, abnormal WT + MO3-fbxo32 Fig. 3 with image from Bühler et al., 2016
skeletal muscle morphology, abnormal WT + MO3-fbxo32 Fig. 2 with image from Bühler et al., 2016
skeletal muscle refractivity, abnormal WT + MO3-fbxo32 Fig. 3 with image,  Fig. S1 with image from Bühler et al., 2016
skeletal muscle vacuolated, abnormal WT + MO3-fbxo32 Fig. 3 with image from Bühler et al., 2016
skeletal muscle mitochondrial crista decreased amount, abnormal WT + MO3-fbxo32 Fig. 6 with image from Bühler et al., 2016
skeletal muscle mitochondrion morphology, abnormal WT + MO3-fbxo32 Fig. 6 with image from Bühler et al., 2016
skeletal muscle myofilament disorganized, abnormal WT + MO3-fbxo32 Fig. 3 with image,  Fig. 6 with image from Bühler et al., 2016
thigmotaxis disrupted, abnormal WT + MO3-fbxo32 Fig. 3 with image from Bühler et al., 2016
whole organism decreased mobility, abnormal WT + MO3-fbxo32 Fig. 3 with image from Bühler et al., 2016
Phenotype of all Fish created by or utilizing MO3-fbxo32
Phenotype Fish Conditions Figures
skeletal muscle myofilament disorganized, abnormal WT + MO3-fbxo32 standard conditions Fig. 3 with image,  Fig. 6 with image from Bühler et al., 2016
cardiac muscle cell sarcomere decreased amount, abnormal WT + MO3-fbxo32 standard conditions Fig. 6 with image from Bühler et al., 2016
thigmotaxis disrupted, abnormal WT + MO3-fbxo32 standard conditions Fig. 3 with image from Bühler et al., 2016
skeletal muscle vacuolated, abnormal WT + MO3-fbxo32 standard conditions Fig. 3 with image from Bühler et al., 2016
heart morphology, abnormal WT + MO3-fbxo32 standard conditions Fig. 2 with image from Bühler et al., 2016
heart contraction decreased rate, abnormal WT + MO3-fbxo32 standard conditions Fig. 4 with image from Bühler et al., 2016
cardiac muscle cell mitochondrion morphology, abnormal WT + MO3-fbxo32 standard conditions Fig. 6 with image from Bühler et al., 2016
skeletal muscle morphology, abnormal WT + MO3-fbxo32 standard conditions Fig. 2 with image from Bühler et al., 2016
heart decreased functionality, abnormal WT + MO3-fbxo32 standard conditions Fig. 4 with image from Bühler et al., 2016
skeletal muscle mitochondrial crista decreased amount, abnormal WT + MO3-fbxo32 standard conditions Fig. 6 with image from Bühler et al., 2016
heart contraction decreased efficacy, abnormal WT + MO3-fbxo32 standard conditions Fig. 4 with image from Bühler et al., 2016
skeletal muscle mitochondrion morphology, abnormal WT + MO3-fbxo32 standard conditions Fig. 6 with image from Bühler et al., 2016
skeletal muscle refractivity, abnormal WT + MO3-fbxo32 standard conditions Fig. 3 with image,  Fig. S1 with image from Bühler et al., 2016
pericardium edematous, abnormal WT + MO3-fbxo32 standard conditions Fig. 2 with image from Bühler et al., 2016
autophagy disrupted, abnormal WT + MO3-fbxo32 standard conditions Fig. 5 with image from Bühler et al., 2016
whole organism decreased mobility, abnormal WT + MO3-fbxo32 standard conditions Fig. 3 with image from Bühler et al., 2016
locomotion involved in locomotory behavior disrupted, abnormal WT + MO3-fbxo32 standard conditions Fig. 3 with image from Bühler et al., 2016
skeletal muscle disorganized, abnormal WT + MO3-fbxo32 standard conditions Fig. 3 with image from Bühler et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.