Morpholino

MO1-atp6ap1b

ID
ZDB-MRPHLNO-160202-1
Name
MO1-atp6ap1b
Previous Names
None
Target
Sequence
5' - AACGCCGCATTCCTACTTCCGTCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-atp6ap1b
Expressed Gene Anatomy Figures
myl7 Fig. 3 with image from Gokey et al., 2015
spaw Fig. 3 with image from Gokey et al., 2015
Phenotype
Phenotype resulting from MO1-atp6ap1b
Phenotype Fish Figures
ciliated cell cell decreased amount, abnormal WT + MO1-atp6ap1b Fig. 2 with image from Gokey et al., 2015
determination of left/right asymmetry in lateral mesoderm decreased occurrence, abnormal WT + MO1-atp6ap1b Fig. 3 with image from Gokey et al., 2015
EVL plasma membrane ab4-atp6v1a labeling decreased amount, abnormal WT + MO1-atp6ap1b Fig. S4 from Gokey et al., 2015
forerunner cell group Ab1-atp6ap1 labeling decreased amount, abnormal s870Tg + MO1-atp6ap1b Fig. 1 with image from Gokey et al., 2015
forerunner cell group cell decreased amount, abnormal s870Tg + MO1-atp6ap1b Fig. 8 with image from Gokey et al., 2015
forerunner cell group cell population proliferation decreased occurrence, abnormal s870Tg + MO1-atp6ap1b Fig. 8 with image from Gokey et al., 2015
forerunner cell group cytoplasm decreased acidity, abnormal s870Tg + MO1-atp6ap1b Fig. 6 with image from Gokey et al., 2015
forerunner cell group plasma membrane ab4-atp6v1a labeling decreased amount, abnormal s870Tg + MO1-atp6ap1b Fig. 7 with image from Gokey et al., 2015
forerunner cell group plasma membrane Ab1-atp6ap1 labeling decreased amount, abnormal s870Tg + MO1-atp6ap1b Fig. 1 with image from Gokey et al., 2015
heart looping decreased occurrence, abnormal WT + MO1-atp6ap1b Fig. 3 with image from Gokey et al., 2015
heart looping process quality, abnormal WT + MO1-atp6ap1b Fig. 3 with image from Gokey et al., 2015
Kupffer's vesicle decreased size, abnormal s870Tg + MO1-atp6ap1b Fig. 2 with image,  Fig. 8 with image from Gokey et al., 2015
Kupffer's vesicle cell decreased amount, abnormal s870Tg + MO1-atp6ap1b Fig. 8 with image from Gokey et al., 2015
Kupffer's vesicle cilium decreased amount, abnormal WT + MO1-atp6ap1b Fig. 2 with image from Gokey et al., 2015
Kupffer's vesicle cilium decreased length, abnormal WT + MO1-atp6ap1b Fig. 2 with image from Gokey et al., 2015
mesoderm spaw expression mislocalised, abnormal WT + MO1-atp6ap1b Fig. 3 with image from Gokey et al., 2015
mesoderm right side spaw expression mislocalised, abnormal WT + MO1-atp6ap1b Fig. 3 with image from Gokey et al., 2015
neuromast decreased size, abnormal WT + MO1-atp6ap1b Fig. 2 with image from Gokey et al., 2015
neuromast kinocilium decreased length, abnormal WT + MO1-atp6ap1b Fig. 2 with image from Gokey et al., 2015
neuromast hair cell basal region ab4-atp6v1a labeling decreased amount, abnormal WT + MO1-atp6ap1b Fig. S4 from Gokey et al., 2015
whole organism Ab1-atp6ap1 labeling decreased amount, abnormal WT + MO1-atp6ap1b Fig. 1 with image from Gokey et al., 2015
Phenotype of all Fish created by or utilizing MO1-atp6ap1b
Phenotype Fish Conditions Figures
mesoderm spaw expression mislocalised, abnormal WT + MO1-atp6ap1b standard conditions Fig. 3 with image from Gokey et al., 2015
neuromast decreased size, abnormal WT + MO1-atp6ap1b standard conditions Fig. 2 with image from Gokey et al., 2015
neuromast kinocilium decreased length, abnormal WT + MO1-atp6ap1b standard conditions Fig. 2 with image from Gokey et al., 2015
Kupffer's vesicle cilium decreased amount, abnormal WT + MO1-atp6ap1b standard conditions Fig. 2 with image from Gokey et al., 2015
heart looping decreased occurrence, abnormal WT + MO1-atp6ap1b standard conditions Fig. 3 with image from Gokey et al., 2015
Kupffer's vesicle cilium decreased length, abnormal WT + MO1-atp6ap1b standard conditions Fig. 2 with image from Gokey et al., 2015
ciliated cell cell decreased amount, abnormal WT + MO1-atp6ap1b standard conditions Fig. 2 with image from Gokey et al., 2015
heart looping process quality, abnormal WT + MO1-atp6ap1b standard conditions Fig. 3 with image from Gokey et al., 2015
Kupffer's vesicle decreased size, abnormal WT + MO1-atp6ap1b standard conditions Fig. 2 with image from Gokey et al., 2015
determination of left/right asymmetry in lateral mesoderm decreased occurrence, abnormal WT + MO1-atp6ap1b standard conditions Fig. 3 with image from Gokey et al., 2015
mesoderm right side spaw expression mislocalised, abnormal WT + MO1-atp6ap1b standard conditions Fig. 3 with image from Gokey et al., 2015
neuromast hair cell basal region ab4-atp6v1a labeling decreased amount, abnormal WT + MO1-atp6ap1b standard conditions Fig. S4 from Gokey et al., 2015
whole organism Ab1-atp6ap1 labeling decreased amount, abnormal WT + MO1-atp6ap1b standard conditions Fig. 1 with image from Gokey et al., 2015
EVL plasma membrane ab4-atp6v1a labeling decreased amount, abnormal WT + MO1-atp6ap1b standard conditions Fig. S4 from Gokey et al., 2015
forerunner cell group cytoplasm decreased acidity, abnormal s870Tg + MO1-atp6ap1b standard conditions Fig. 6 with image from Gokey et al., 2015
forerunner cell group cell decreased amount, abnormal s870Tg + MO1-atp6ap1b standard conditions Fig. 8 with image from Gokey et al., 2015
forerunner cell group cell population proliferation decreased occurrence, abnormal s870Tg + MO1-atp6ap1b standard conditions Fig. 8 with image from Gokey et al., 2015
Kupffer's vesicle cell decreased amount, abnormal s870Tg + MO1-atp6ap1b standard conditions Fig. 8 with image from Gokey et al., 2015
forerunner cell group plasma membrane ab4-atp6v1a labeling decreased amount, abnormal s870Tg + MO1-atp6ap1b standard conditions Fig. 7 with image from Gokey et al., 2015
Kupffer's vesicle decreased size, abnormal s870Tg + MO1-atp6ap1b standard conditions Fig. 2 with image,  Fig. 8 with image from Gokey et al., 2015
forerunner cell group Ab1-atp6ap1 labeling decreased amount, abnormal s870Tg + MO1-atp6ap1b standard conditions Fig. 1 with image from Gokey et al., 2015
forerunner cell group plasma membrane Ab1-atp6ap1 labeling decreased amount, abnormal s870Tg + MO1-atp6ap1b standard conditions Fig. 1 with image from Gokey et al., 2015
heart looping decreased occurrence, abnormal WT + MO1-atp6ap1b + MO1-atp6v1f standard conditions Fig. S4 from Gokey et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.