Morpholino
MO1-foxo1a
- ID
- ZDB-MRPHLNO-160126-7
- Name
- MO1-foxo1a
- Previous Names
- None
- Target
- Sequence
-
5' - TGAAGAGCCAGCTATTAAGAGAGTA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-foxo1a
No data available
Phenotype
Phenotype resulting from MO1-foxo1a
No data available
Phenotype of all Fish created by or utilizing MO1-foxo1a
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| lymph vessel development occurrence, ameliorated | y1Tg + MO1-foxo1a + MO3-dre-mir-182 + MO4-tp53 | control |
Fig. 7
from Kiesow et al., 2015 |
| vascular lymphangioblast absent, ameliorated | y1Tg + MO1-foxo1a + MO3-dre-mir-182 + MO4-tp53 | control |
Fig. 7
from Kiesow et al., 2015 |
Citations