Morpholino

MO3-mir182

ID
ZDB-MRPHLNO-160126-2
Name
MO3-mir182
Previous Names
  • miR-182-MO (1)
Target
Sequence
5' - AGTGTGAGTTCTACCATTGCCAAAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-mir182
No data available
Phenotype
Phenotype resulting from MO3-mir182
Phenotype of all Fish created by or utilizing MO3-mir182
Citations