Morpholino

MO2-msrb3

ID

ZDB-MRPHLNO-160126-10

Name

MO2-msrb3

Previous Names

Ex2MO (1)

Target

msrb3 (1)

Sequence

5' - CACGTTCCTAATGGAAATACAAGCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-msrb3

No data available

Phenotype

Phenotype resulting from MO2-msrb3

Phenotype	Fish	Figures
apoptotic process increased process quality, abnormal	AB + MO2-msrb3 + MO4-tp53	Fig. 5 from Shen et al., 2015
inner ear decreased size, abnormal	AB + MO2-msrb3	Fig. 2 from Shen et al., 2015
inner ear stereocilium decreased length, abnormal	AB + MO2-msrb3	Fig. 3 from Shen et al., 2015
inner ear stereocilium decreased width, abnormal	AB + MO2-msrb3	Fig. 3 from Shen et al., 2015
neuromast decreased amount, abnormal	s356tTg + MO2-msrb3	Fig. 4 from Shen et al., 2015
neuromast kinocilium decreased length, abnormal	AB + MO2-msrb3	Fig. 3 from Shen et al., 2015
neuromast hair cell decreased amount, abnormal	s356tTg + MO2-msrb3	Fig. 4 from Shen et al., 2015
neuromast hair cell apoptotic process increased process quality, abnormal	AB + MO2-msrb3	Fig. 5 from Shen et al., 2015
otolith amount, abnormal	AB + MO2-msrb3	Fig. 2 from Shen et al., 2015
otolith decreased size, abnormal	AB + MO2-msrb3	Fig. 2 from Shen et al., 2015
otolith fused with otolith, abnormal	AB + MO2-msrb3	Fig. 2 from Shen et al., 2015
otolith mislocalised, abnormal	AB + MO2-msrb3	Fig. 2 from Shen et al., 2015
semicircular canal malformed, abnormal	AB + MO2-msrb3	Fig. 2 , Fig. 3 from Shen et al., 2015
sensory perception of sound decreased process quality, abnormal	AB + MO2-msrb3	Fig. 7 from Shen et al., 2015
startle response decreased process quality, abnormal	AB + MO2-msrb3	Fig. 7 from Shen et al., 2015
swimming behavior decreased process quality, abnormal	AB + MO2-msrb3	Fig. 7 from Shen et al., 2015

Phenotype of all Fish created by or utilizing MO2-msrb3

Phenotype	Fish	Conditions	Figures
semicircular canal malformed, abnormal	AB + MO2-msrb3	control	Fig. 2 , Fig. 3 from Shen et al., 2015
neuromast kinocilium decreased length, abnormal	AB + MO2-msrb3	control	Fig. 3 from Shen et al., 2015
otolith mislocalised, abnormal	AB + MO2-msrb3	control	Fig. 2 from Shen et al., 2015
otolith decreased size, abnormal	AB + MO2-msrb3	control	Fig. 2 from Shen et al., 2015
otolith amount, abnormal	AB + MO2-msrb3	control	Fig. 2 from Shen et al., 2015
inner ear stereocilium decreased length, abnormal	AB + MO2-msrb3	control	Fig. 3 from Shen et al., 2015
inner ear decreased size, abnormal	AB + MO2-msrb3	control	Fig. 2 from Shen et al., 2015
inner ear stereocilium decreased width, abnormal	AB + MO2-msrb3	control	Fig. 3 from Shen et al., 2015
startle response decreased process quality, abnormal	AB + MO2-msrb3	control	Fig. 7 from Shen et al., 2015
sensory perception of sound decreased process quality, abnormal	AB + MO2-msrb3	control	Fig. 7 from Shen et al., 2015
otolith fused with otolith, abnormal	AB + MO2-msrb3	control	Fig. 2 from Shen et al., 2015
neuromast hair cell apoptotic process increased process quality, abnormal	AB + MO2-msrb3	control	Fig. 5 from Shen et al., 2015
swimming behavior decreased process quality, abnormal	AB + MO2-msrb3	control	Fig. 7 from Shen et al., 2015
apoptotic process increased process quality, abnormal	AB + MO2-msrb3 + MO4-tp53	control	Fig. 5 from Shen et al., 2015
neuromast decreased amount, abnormal	s356tTg + MO2-msrb3	control	Fig. 4 from Shen et al., 2015
neuromast hair cell decreased amount, abnormal	s356tTg + MO2-msrb3	control	Fig. 4 from Shen et al., 2015

Citations