Morpholino

MO2-rdh10a

ID
ZDB-MRPHLNO-160106-2
Name
MO2-rdh10a
Previous Names
None
Target
Sequence
5' - TAAAAAGAGGCTCACCCAGAAGTGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-rdh10a
No data available
Phenotype
Phenotype resulting from MO2-rdh10a
No data available
Phenotype of all Fish created by or utilizing MO2-rdh10a
Phenotype Fish Conditions Figures
extension shape, abnormal WT + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 1 with image from D'Aniello et al., 2015
anatomical structure cyp26a1 expression decreased amount, abnormal WT + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 2 with image from D'Aniello et al., 2015
anatomical structure dhrs3a expression decreased amount, abnormal WT + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 2 with image from D'Aniello et al., 2015
pericardium edematous, abnormal WT + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 1 with image from D'Aniello et al., 2015
anatomical structure hoxb5b expression decreased amount, abnormal WT + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 2 with image from D'Aniello et al., 2015
extension increased thickness, abnormal WT + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 1 with image from D'Aniello et al., 2015
whole organism myl7 expression increased amount, abnormal WT + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 3 with image from D'Aniello et al., 2015
whole organism myh7 expression increased amount, abnormal WT + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 3 with image from D'Aniello et al., 2015
whole organism hoxb5b expression decreased amount, abnormal WT + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 2 with image from D'Aniello et al., 2015
whole organism cyp26a1 expression decreased amount, abnormal WT + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 2 with image from D'Aniello et al., 2015
whole organism dhrs3a expression decreased amount, abnormal WT + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 2 with image from D'Aniello et al., 2015
whole organism myh6 expression increased amount, abnormal WT + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 3 with image from D'Aniello et al., 2015
atrium cardiac muscle cell increased amount, abnormal f2Tg + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 3 with image from D'Aniello et al., 2015
cardiac muscle cell increased amount, abnormal f2Tg + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 3 with image from D'Aniello et al., 2015
cardiac ventricle cardiac muscle cell increased amount, abnormal f2Tg + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 3 with image from D'Aniello et al., 2015
whole organism EGFP expression decreased amount, abnormal sk72Tg + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 1 with image from D'Aniello et al., 2015
spinal cord EGFP expression decreased distribution, abnormal sk72Tg + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 1 with image from D'Aniello et al., 2015
spinal cord EGFP expression decreased amount, abnormal sk72Tg + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 1 with image from D'Aniello et al., 2015
retinoic acid receptor signaling pathway decreased occurrence, abnormal sk72Tg + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 1 with image from D'Aniello et al., 2015
head increased size, abnormal aldh1a2i26/i26 + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 4 with image from D'Aniello et al., 2015
pericardium edematous, abnormal aldh1a2i26/i26 + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 4 with image from D'Aniello et al., 2015
whole organism decreased length, abnormal aldh1a2i26/i26 + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 4 with image from D'Aniello et al., 2015
nervous system wholly anterioralized, abnormal aldh1a2i26/i26 + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 4 with image from D'Aniello et al., 2015
Citations