Morpholino

MO4-tgfb1a

ID
ZDB-MRPHLNO-151211-4
Name
MO4-tgfb1a
Previous Names
None
Target
Sequence
5' - AAGGAAAAAACGAAATGGAAAGGAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-tgfb1a
Expressed Gene Anatomy Figures
ackr3b Fig. 3 from Xing et al., 2015
atoh1a Fig. 4 from Xing et al., 2015
axin2 Fig. 4 from Xing et al., 2015
cdh1 Fig. 3 from Xing et al., 2015
cdh2 Fig. 3 from Xing et al., 2015
cdh4 Fig. 3 from Xing et al., 2015
cdh6 Fig. 3 from Xing et al., 2015
cxcl12a Fig. 3 from Xing et al., 2015
cxcr4b Fig. 3 from Xing et al., 2015
dla Fig. 4 from Xing et al., 2015
etv4 Fig. 4 from Xing et al., 2015
eya1 Fig. 2 from Xing et al., 2015
fgf3 Fig. 4 from Xing et al., 2015
fgf10a Fig. 4 from Xing et al., 2015
lef1 Fig. 4 from Xing et al., 2015
Phenotype
Phenotype resulting from MO4-tgfb1a
Phenotype Fish Figures
posterior lateral line neuromast decreased amount, abnormal zf106Tg + MO4-tgfb1a + MO5-tp53 Fig. 1,  Fig. 5 from Xing et al., 2015
posterior lateral line neuromast far from posterior lateral line neuromast, abnormal zf106Tg + MO4-tgfb1a Fig. 1,  Fig. 5 from Xing et al., 2015
posterior lateral line neuromast irregular spatial pattern, abnormal zf106Tg + MO4-tgfb1a Fig. 1 from Xing et al., 2015
posterior lateral line neuromast neuromast hair cell decreased amount, abnormal zf106Tg + MO4-tgfb1a Fig. 4 from Xing et al., 2015
posterior lateral line neuromast deposition decreased occurrence, abnormal zf106Tg + MO4-tgfb1a Fig. 2 from Xing et al., 2015
posterior lateral line neuromast primordium migration decreased rate, abnormal zf106Tg + MO4-tgfb1a Fig. 2 from Xing et al., 2015
Phenotype of all Fish created by or utilizing MO4-tgfb1a
Phenotype Fish Conditions Figures
posterior lateral line neuromast primordium migration decreased rate, abnormal TU + MO4-tgfb1a standard conditions Fig. 2 from Xing et al., 2015
posterior lateral line neuromast deposition decreased occurrence, abnormal zf106Tg + MO4-tgfb1a standard conditions Fig. 2 from Xing et al., 2015
posterior lateral line neuromast far from posterior lateral line neuromast, abnormal zf106Tg + MO4-tgfb1a standard conditions Fig. 1,  Fig. 5 from Xing et al., 2015
posterior lateral line neuromast irregular spatial pattern, abnormal zf106Tg + MO4-tgfb1a standard conditions Fig. 1 from Xing et al., 2015
posterior lateral line neuromast neuromast hair cell decreased amount, abnormal zf106Tg + MO4-tgfb1a standard conditions Fig. 4 from Xing et al., 2015
posterior lateral line neuromast decreased amount, abnormal zf106Tg + MO4-tgfb1a standard conditions Fig. 1,  Fig. 5 from Xing et al., 2015
posterior lateral line neuromast primordium migration decreased rate, abnormal zf106Tg + MO4-tgfb1a standard conditions Fig. 2 from Xing et al., 2015
posterior lateral line neuromast decreased amount, abnormal zf106Tg + MO4-tgfb1a + MO5-tp53 standard conditions Fig. 1 from Xing et al., 2015
posterior lateral line neuromast far from posterior lateral line neuromast, abnormal zf106Tg + MO4-tgfb1a + MO5-tp53 standard conditions Fig. 1 from Xing et al., 2015
posterior lateral line neuromast irregular spatial pattern, abnormal zf106Tg + MO4-tgfb1a + MO5-tp53 standard conditions Fig. 1 from Xing et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.