Morpholino

MO1-adgra2

ID
ZDB-MRPHLNO-150904-2
Name
MO1-adgra2
Previous Names
None
Target
Sequence
5' - ACTGATATTGATTTAACTCACCACA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-adgra2
No data available
Phenotype
Phenotype resulting from MO1-adgra2
Phenotype Fish Figures
brain central artery EGFP expression spatial pattern, abnormal s843Tg/s843Tg + MO1-adgra2 Fig. 1 with image from America et al., 2022
central artery absent, abnormal s843Tg + MO1-adgra2 Fig. 3 with image from Vanhollebeke et al., 2015
central artery decreased amount, abnormal WT + MO1-adgra2 Fig. 4,  Fig. 5 from Eubelen et al., 2018
central artery Wnt receptor activity decreased efficacy, abnormal s843Tg/s843Tg + MO1-adgra2 Fig. 1 with image,  Fig. 7 with image from America et al., 2022
central artery Wnt-Frizzled-LRP5/6 complex decreased functionality, abnormal s843Tg/s843Tg + MO1-adgra2 Fig. 7 with image from America et al., 2022
dorsal root ganglion decreased amount, abnormal sb1Tg; vu234Tg + MO1-adgra2 Fig. 2 from Bostaille et al., 2017
Fig. 3 with image from Vanhollebeke et al., 2015
dorsal root ganglion Wnt signaling pathway decreased process quality, abnormal ia4Tg; vu234Tg + MO1-adgra2 Fig. 3 with image from Vanhollebeke et al., 2015
hindbrain brain vasculature decreased amount, abnormal WT + MO1-adgra2 Fig. 4,  Fig. 5 from Eubelen et al., 2018
hindbrain central artery absent, abnormal ia4Tg; s896Tg + MO1-adgra2 Fig. 3 with image from Vanhollebeke et al., 2015
hindbrain central artery decreased amount, abnormal WT + MO1-adgra2 Fig. 2 from Bostaille et al., 2017
Fig. 1 with image,  Fig. 3 with image from Vanhollebeke et al., 2015
hindbrain central artery irregular spatial pattern, abnormal s843Tg/s843Tg + MO1-adgra2 Fig. 7 with image from America et al., 2022
hindbrain central artery EGFP expression spatial pattern, abnormal s843Tg/s843Tg + MO1-adgra2 Fig. 4 with image,  Fig. 7 with image from America et al., 2022
hindbrain vasculature EGFP expression decreased amount, abnormal ia4Tg + MO1-adgra2 Fig. 5 with image from Fetsko et al., 2022
primordial hindbrain channel EGFP expression spatial pattern, abnormal s843Tg/s843Tg + MO1-adgra2 Fig. 4 with image,  Fig. 7 with image from America et al., 2022
primordial hindbrain channel Wnt signaling pathway decreased process quality, abnormal ia4Tg; s896Tg + MO1-adgra2 Fig. 3 with image from Vanhollebeke et al., 2015
Phenotype of all Fish created by or utilizing MO1-adgra2
Phenotype Fish Conditions Figures
brain central artery EGFP expression spatial pattern, abnormal s843Tg/s843Tg + MO1-adgra2 standard conditions Fig. 1 with image from America et al., 2022
primordial hindbrain channel EGFP expression spatial pattern, abnormal s843Tg/s843Tg + MO1-adgra2 standard conditions Fig. 4 with image,  Fig. 7 with image from America et al., 2022
hindbrain central artery irregular spatial pattern, abnormal s843Tg/s843Tg + MO1-adgra2 standard conditions Fig. 7 with image from America et al., 2022
central artery Wnt-Frizzled-LRP5/6 complex decreased functionality, abnormal s843Tg/s843Tg + MO1-adgra2 standard conditions Fig. 7 with image from America et al., 2022
central artery Wnt receptor activity decreased efficacy, abnormal s843Tg/s843Tg + MO1-adgra2 standard conditions Fig. 1 with image,  Fig. 7 with image from America et al., 2022
hindbrain central artery EGFP expression spatial pattern, abnormal s843Tg/s843Tg + MO1-adgra2 standard conditions Fig. 4 with image,  Fig. 7 with image from America et al., 2022
hindbrain brain vasculature decreased amount, abnormal WT + MO1-adgra2 control Fig. 4,  Fig. 5 from Eubelen et al., 2018
central artery decreased amount, abnormal WT + MO1-adgra2 control Fig. 4,  Fig. 5 from Eubelen et al., 2018
hindbrain central artery decreased amount, abnormal WT + MO1-adgra2 standard conditions Fig. 2 from Bostaille et al., 2017
hindbrain vasculature EGFP expression decreased amount, abnormal ia4Tg + MO1-adgra2 standard conditions Fig. 5 with image from Fetsko et al., 2022
central artery absent, abnormal s843Tg + MO1-adgra2 control Fig. 3 with image from Vanhollebeke et al., 2015
hindbrain central artery decreased amount, abnormal s843Tg + MO1-adgra2 standard conditions Fig. 1 with image from Vanhollebeke et al., 2015
dorsal root ganglion decreased amount, abnormal w61Tg + MO1-adgra2 standard conditions Fig. 2 from Bostaille et al., 2017
hindbrain central artery absent, abnormal ia4Tg; s896Tg + MO1-adgra2 standard conditions Fig. 3 with image from Vanhollebeke et al., 2015
hindbrain central artery decreased amount, abnormal ia4Tg; s896Tg + MO1-adgra2 standard conditions Fig. 3 with image from Vanhollebeke et al., 2015
primordial hindbrain channel Wnt signaling pathway decreased process quality, abnormal ia4Tg; s896Tg + MO1-adgra2 standard conditions Fig. 3 with image from Vanhollebeke et al., 2015
dorsal root ganglion Wnt signaling pathway decreased process quality, abnormal ia4Tg; vu234Tg + MO1-adgra2 standard conditions Fig. 3 with image from Vanhollebeke et al., 2015
dorsal root ganglion decreased amount, abnormal sb1Tg; vu234Tg + MO1-adgra2 control Fig. 3 with image from Vanhollebeke et al., 2015
primordial hindbrain channel Wnt signaling pathway decreased process quality, abnormal ncv15Tg; ncv1Tg; nkuasgfp1aTg + MO1-adgra2 standard conditions Fig. 3 with image from Vanhollebeke et al., 2015
basilar artery Wnt signaling pathway decreased process quality, abnormal ncv15Tg; ncv1Tg; nkuasgfp1aTg + MO1-adgra2 standard conditions Fig. 3 with image from Vanhollebeke et al., 2015
Citations