Morpholino

MO1-gata2b

ID

ZDB-MRPHLNO-150601-4

Name

MO1-gata2b

Previous Names

None

Target

Sequence

5' - TTCACGTCCTATTGGCACACGATGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-gata2b

Expressed Gene	Anatomy	Figures
cdh17	pronephric duct	Fig. S4 from Butko et al., 2015
efnb2a	artery	Fig. 5 from Butko et al., 2015
etsrp	posterior lateral mesoderm	Fig. S4 from Butko et al., 2015
gata1a	erythroid lineage cell posterior lateral mesoderm	Fig. S4 from Butko et al., 2015
gata2b	ventral wall of dorsal aorta	Fig. S4 from Butko et al., 2015
kdrl	vasculature	Fig. 5 from Butko et al., 2015
lcp1	macrophage	Fig. S4 from Butko et al., 2015
myb	caudal hematopoietic tissue hematopoietic cell	Fig. 5 from Dobrzycki et al., 2020 Fig. 5 from Butko et al., 2015
myod1	somite	Fig. S4 from Butko et al., 2015
rag1	thymus hematopoietic cell	Fig. 5 from Butko et al., 2015
runx1	dorsal aorta posterior lateral mesoderm ventral wall of dorsal aorta	Fig. 5 from Dobrzycki et al., 2020 Fig. 5 , Fig. S4 from Butko et al., 2015
tal1	erythroid lineage cell posterior lateral mesoderm	Fig. S4 from Butko et al., 2015

Phenotype

Phenotype resulting from MO1-gata2b

Phenotype	Fish	Figures
definitive hemopoiesis process quality, abnormal	WT + MO1-gata2b	Fig. 5 from Butko et al., 2015
hematopoietic stem cell differentiation process quality, abnormal	WT + MO1-gata2b	Fig. 5 from Butko et al., 2015
hemopoiesis process quality, abnormal	WT + MO1-gata2b	Fig. 5 from Butko et al., 2015
ventral wall of dorsal aorta Citrine expression decreased amount, abnormal	ox1Tg + MO1-gata2b	Fig. S1 from Bonkhofer et al., 2019

Phenotype of all Fish created by or utilizing MO1-gata2b

Phenotype	Fish	Conditions	Figures
definitive hemopoiesis process quality, abnormal	WT + MO1-gata2b	standard conditions	Fig. 5 from Butko et al., 2015
hemopoiesis process quality, abnormal	WT + MO1-gata2b	standard conditions	Fig. 5 from Butko et al., 2015
hematopoietic stem cell differentiation process quality, abnormal	WT + MO1-gata2b	standard conditions	Fig. 5 from Butko et al., 2015
ventral wall of dorsal aorta Citrine expression decreased amount, abnormal	ox1Tg + MO1-gata2b	standard conditions	Fig. S1 from Bonkhofer et al., 2019
dorsal aorta runx1 expression decreased amount, abnormal	en.gata2a.i4^{uob101/uob101} + MO1-gata2b	standard conditions	Fig. 5 from Dobrzycki et al., 2020
caudal hematopoietic tissue myb expression decreased amount, abnormal	en.gata2a.i4^{uob101/uob101} + MO1-gata2b	standard conditions	Fig. 5 from Dobrzycki et al., 2020
hematopoietic cell decreased amount, exacerbated	en.gata2a.i4^{uob101/uob101} + MO1-gata2b	standard conditions	Fig. 5 from Dobrzycki et al., 2020

Citations