Morpholino
MO1-anln
- ID
- ZDB-MRPHLNO-150520-5
- Name
- MO1-anln
- Previous Names
-
- ATGMO (1)
- Target
- Sequence
-
5' - GTACGCTACAAGCTGAAAGTAAAGT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO. Targets the 5'UTR.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-anln
No data available
Phenotype
Phenotype resulting from MO1-anln
Phenotype of all Fish created by or utilizing MO1-anln
Citations
- Covello, G., Rossello, F.J., Filosi, M., Gajardo, F., Duchemin, A.L., Tremonti, B.F., Eichenlaub, M., Polo, J.M., Powell, D., Ngai, J., Allende, M.L., Domenici, E., Ramialison, M., Poggi, L. (2020) Transcriptome analysis of the zebrafish atoh7-/- Mutant, lakritz, highlights Atoh7-dependent genetic networks with potential implications for human eye diseases. FASEB bioAdvances. 2:434-448
- Paolini, A., Duchemin, A.L., Albadri, S., Patzel, E., Bornhorst, D., González Avalos, P., Lemke, S., Machate, A., Brand, M., Sel, S., Di Donato, V., Del Bene, F., Zolessi, F.R., Ramialison, M., Poggi, L. (2015) Asymmetric inheritance of the apical domain and self-renewal of retinal ganglion cell progenitors depend on Anillin function. Development (Cambridge, England). 142(5):832-9
1 - 2 of 2
Show