Morpholino

MO3-pappa2

ID
ZDB-MRPHLNO-150224-3
Name
MO3-pappa2
Previous Names
  • i3e4 (1)
Target
Sequence
5' - TTCCACCTGAAAAATGACACAAAGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-pappa2
No data available
Phenotype
Phenotype resulting from MO3-pappa2
Phenotype Fish Figures
ceratohyal cartilage absent, abnormal WT + MO3-pappa2 + MO4-tp53 Fig. 4 with image from Kjaer-Sorensen et al., 2014
ceratohyal cartilage decreased size, abnormal WT + MO3-pappa2 + MO4-tp53 Fig. 4 with image from Kjaer-Sorensen et al., 2014
cranial neural crest cell decreased amount, abnormal WT + MO3-pappa2 + MO4-tp53 Fig. 4 with image from Kjaer-Sorensen et al., 2014
ethmoid cartilage decreased size, abnormal WT + MO3-pappa2 + MO4-tp53 Fig. 4 with image from Kjaer-Sorensen et al., 2014
hyosymplectic cartilage absent, abnormal WT + MO3-pappa2 + MO4-tp53 Fig. 4 with image from Kjaer-Sorensen et al., 2014
hyosymplectic cartilage decreased size, abnormal WT + MO3-pappa2 + MO4-tp53 Fig. 4 with image from Kjaer-Sorensen et al., 2014
Meckel's cartilage absent, abnormal WT + MO3-pappa2 + MO4-tp53 Fig. 4 with image from Kjaer-Sorensen et al., 2014
Meckel's cartilage decreased size, abnormal WT + MO3-pappa2 + MO4-tp53 Fig. 4 with image from Kjaer-Sorensen et al., 2014
neurocranial trabecula absent, abnormal WT + MO3-pappa2 + MO4-tp53 Fig. 4 with image from Kjaer-Sorensen et al., 2014
neurocranial trabecula decreased size, abnormal WT + MO3-pappa2 + MO4-tp53 Fig. 4 with image from Kjaer-Sorensen et al., 2014
Notch signaling pathway disrupted, abnormal um13Tg + MO3-pappa2 + MO4-tp53 Fig. 7 with image from Kjaer-Sorensen et al., 2014
notochord undulate, abnormal WT + MO3-pappa2 + MO4-tp53 Fig. 3 with image from Kjaer-Sorensen et al., 2014
palatoquadrate arch absent, abnormal WT + MO3-pappa2 + MO4-tp53 Fig. 4 with image from Kjaer-Sorensen et al., 2014
palatoquadrate arch decreased size, abnormal WT + MO3-pappa2 + MO4-tp53 Fig. 4 with image from Kjaer-Sorensen et al., 2014
pharyngeal arch 3-7 decreased size, abnormal WT + MO3-pappa2 + MO4-tp53 Fig. 4 with image from Kjaer-Sorensen et al., 2014
regulation of Notch signaling pathway disrupted, abnormal um13Tg + MO3-pappa2 + MO4-tp53 Fig. 6 with image from Kjaer-Sorensen et al., 2014
trunk curved ventral, abnormal WT + MO3-pappa2 + MO4-tp53 Fig. 3 with image from Kjaer-Sorensen et al., 2014
Phenotype of all Fish created by or utilizing MO3-pappa2
Phenotype Fish Conditions Figures
palatoquadrate arch decreased size, abnormal WT + MO3-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
hyosymplectic cartilage absent, abnormal WT + MO3-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
neurocranial trabecula decreased size, abnormal WT + MO3-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
Meckel's cartilage decreased size, abnormal WT + MO3-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
cranial neural crest cell decreased amount, abnormal WT + MO3-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
Meckel's cartilage absent, abnormal WT + MO3-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
palatoquadrate arch absent, abnormal WT + MO3-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
trunk curved ventral, abnormal WT + MO3-pappa2 + MO4-tp53 standard conditions Fig. 3 with image from Kjaer-Sorensen et al., 2014
neurocranial trabecula absent, abnormal WT + MO3-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
ceratohyal cartilage decreased size, abnormal WT + MO3-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
ethmoid cartilage decreased size, abnormal WT + MO3-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
hyosymplectic cartilage decreased size, abnormal WT + MO3-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
ceratohyal cartilage absent, abnormal WT + MO3-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
notochord undulate, abnormal WT + MO3-pappa2 + MO4-tp53 standard conditions Fig. 3 with image from Kjaer-Sorensen et al., 2014
pharyngeal arch 3-7 decreased size, abnormal WT + MO3-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
Notch signaling pathway disrupted, abnormal um13Tg + MO3-pappa2 + MO4-tp53 standard conditions Fig. 7 with image from Kjaer-Sorensen et al., 2014
regulation of Notch signaling pathway disrupted, abnormal um13Tg + MO3-pappa2 + MO4-tp53 standard conditions Fig. 6 with image from Kjaer-Sorensen et al., 2014
Citations