Morpholino

MO2-pappa2

ID
ZDB-MRPHLNO-150224-2
Name
MO2-pappa2
Previous Names
None
Target
Sequence
5' - CATCATTTTATTGAGGAGAAGCTGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-pappa2
No data available
Phenotype
Phenotype resulting from MO2-pappa2
Phenotype Fish Figures
angiogenesis disrupted, abnormal y1Tg + MO2-pappa2 + MO4-tp53 Fig. 6 with image from Kjaer-Sorensen et al., 2014
ceratohyal cartilage absent, abnormal WT + MO2-pappa2 + MO4-tp53 Fig. 4 with image from Kjaer-Sorensen et al., 2014
ceratohyal cartilage decreased size, abnormal WT + MO2-pappa2 + MO4-tp53 Fig. 4 with image from Kjaer-Sorensen et al., 2014
cranial neural crest cell decreased amount, abnormal WT + MO2-pappa2 + MO4-tp53 Fig. 4 with image from Kjaer-Sorensen et al., 2014
ethmoid cartilage decreased size, abnormal WT + MO2-pappa2 + MO4-tp53 Fig. 4 with image from Kjaer-Sorensen et al., 2014
hyosymplectic cartilage absent, abnormal WT + MO2-pappa2 + MO4-tp53 Fig. 4 with image from Kjaer-Sorensen et al., 2014
hyosymplectic cartilage decreased size, abnormal WT + MO2-pappa2 + MO4-tp53 Fig. 4 with image from Kjaer-Sorensen et al., 2014
intersegmental vessel branched, abnormal y1Tg + MO2-pappa2 + MO4-tp53 Fig. 6 with image from Kjaer-Sorensen et al., 2014
intersegmental vessel decreased size, abnormal y1Tg + MO2-pappa2 + MO4-tp53 Fig. 6 with image from Kjaer-Sorensen et al., 2014
intersegmental vessel extends beyond somite, abnormal y1Tg + MO2-pappa2 + MO4-tp53 Fig. 6 with image from Kjaer-Sorensen et al., 2014
Meckel's cartilage absent, abnormal WT + MO2-pappa2 + MO4-tp53 Fig. 4 with image from Kjaer-Sorensen et al., 2014
Meckel's cartilage decreased size, abnormal WT + MO2-pappa2 + MO4-tp53 Fig. 4 with image from Kjaer-Sorensen et al., 2014
neurocranial trabecula absent, abnormal WT + MO2-pappa2 + MO4-tp53 Fig. 4 with image from Kjaer-Sorensen et al., 2014
neurocranial trabecula decreased size, abnormal WT + MO2-pappa2 + MO4-tp53 Fig. 4 with image from Kjaer-Sorensen et al., 2014
Notch signaling pathway disrupted, abnormal um13Tg + MO2-pappa2 + MO4-tp53 Fig. 7 with image from Kjaer-Sorensen et al., 2014
notochord undulate, abnormal WT + MO2-pappa2 + MO4-tp53 Fig. 3 with image from Kjaer-Sorensen et al., 2014
palatoquadrate arch absent, abnormal WT + MO2-pappa2 + MO4-tp53 Fig. 4 with image from Kjaer-Sorensen et al., 2014
palatoquadrate arch decreased size, abnormal WT + MO2-pappa2 + MO4-tp53 Fig. 4 with image from Kjaer-Sorensen et al., 2014
pharyngeal arch 3-7 decreased size, abnormal WT + MO2-pappa2 + MO4-tp53 Fig. 4 with image from Kjaer-Sorensen et al., 2014
regulation of Notch signaling pathway disrupted, abnormal um13Tg + MO2-pappa2 + MO4-tp53 Fig. 6 with image from Kjaer-Sorensen et al., 2014
trunk curved ventral, abnormal WT + MO2-pappa2 + MO4-tp53 Fig. 3 with image from Kjaer-Sorensen et al., 2014
Phenotype of all Fish created by or utilizing MO2-pappa2
Phenotype Fish Conditions Figures
hyosymplectic cartilage decreased size, abnormal WT + MO2-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
ceratohyal cartilage absent, abnormal WT + MO2-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
cranial neural crest cell decreased amount, abnormal WT + MO2-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
neurocranial trabecula absent, abnormal WT + MO2-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
ethmoid cartilage decreased size, abnormal WT + MO2-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
neurocranial trabecula decreased size, abnormal WT + MO2-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
palatoquadrate arch decreased size, abnormal WT + MO2-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
notochord undulate, abnormal WT + MO2-pappa2 + MO4-tp53 standard conditions Fig. 3 with image from Kjaer-Sorensen et al., 2014
Meckel's cartilage absent, abnormal WT + MO2-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
Meckel's cartilage decreased size, abnormal WT + MO2-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
trunk curved ventral, abnormal WT + MO2-pappa2 + MO4-tp53 standard conditions Fig. 3 with image from Kjaer-Sorensen et al., 2014
ceratohyal cartilage decreased size, abnormal WT + MO2-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
pharyngeal arch 3-7 decreased size, abnormal WT + MO2-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
hyosymplectic cartilage absent, abnormal WT + MO2-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
palatoquadrate arch absent, abnormal WT + MO2-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
Notch signaling pathway disrupted, abnormal um13Tg + MO2-pappa2 + MO4-tp53 standard conditions Fig. 7 with image from Kjaer-Sorensen et al., 2014
regulation of Notch signaling pathway disrupted, abnormal um13Tg + MO2-pappa2 + MO4-tp53 standard conditions Fig. 6 with image from Kjaer-Sorensen et al., 2014
intersegmental vessel extends beyond somite, abnormal y1Tg + MO2-pappa2 + MO4-tp53 standard conditions Fig. 6 with image from Kjaer-Sorensen et al., 2014
intersegmental vessel decreased size, abnormal y1Tg + MO2-pappa2 + MO4-tp53 standard conditions Fig. 6 with image from Kjaer-Sorensen et al., 2014
angiogenesis disrupted, abnormal y1Tg + MO2-pappa2 + MO4-tp53 standard conditions Fig. 6 with image from Kjaer-Sorensen et al., 2014
intersegmental vessel branched, abnormal y1Tg + MO2-pappa2 + MO4-tp53 standard conditions Fig. 6 with image from Kjaer-Sorensen et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.