Morpholino

MO2-stx1b

ID
ZDB-MRPHLNO-150212-9
Name
MO2-stx1b
Previous Names
None
Target
Sequence
5' - AAATATCTCTTGAGATGTCCGCTGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO, targets the 5'UTR.
Genome Resources
None
Target Location
Genome Build: GRCz11Chromosome: 19
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-stx1b
Expressed Gene Anatomy Figures
fosab Fig. 3 with image,  Fig. 6 with image from Zheng et al., 2018
stx1b Fig. 3 with image,  Fig. 7 with image from Zheng et al., 2018
Phenotype
Phenotype resulting from MO2-stx1b
Phenotype Fish Figures
brain stx1b expression decreased amount, abnormal AB + MO2-stx1b Fig. 3 with image,  Fig. 7 with image from Zheng et al., 2018
whole organism Ab1-stx1b labeling decreased amount, abnormal AB + MO2-stx1b Fig. 3 with image,  Fig. 7 with image from Zheng et al., 2018
Phenotype of all Fish created by or utilizing MO2-stx1b
Phenotype Fish Conditions Figures
optic tectum neuronal action potential increased frequency, abnormal AB + MO1-stx1b + MO2-stx1b heat shock Fig. 4 from Schubert et al., 2014
optic tectum neuronal action potential irregular rhythm, abnormal AB + MO1-stx1b + MO2-stx1b standard conditions Fig. 3,  Fig. 5 from Schubert et al., 2014
musculoskeletal movement irregular rhythm, abnormal AB + MO1-stx1b + MO2-stx1b standard conditions text only from Schubert et al., 2014
optic tectum regulation of neuronal action potential decreased process quality, abnormal AB + MO1-stx1b + MO2-stx1b heat shock Fig. 4 from Schubert et al., 2014
musculoskeletal movement decreased coordination, abnormal AB + MO1-stx1b + MO2-stx1b standard conditions text only from Schubert et al., 2014
optic tectum neuronal action potential increased frequency, abnormal AB + MO1-stx1b + MO2-stx1b chemical treatment: double-stranded DNA fragment Fig. 5 from Schubert et al., 2014
thigmotaxis decreased occurrence, abnormal AB + MO1-stx1b + MO2-stx1b standard conditions text only from Schubert et al., 2014
musculoskeletal movement episodic, abnormal AB + MO1-stx1b + MO2-stx1b standard conditions text only from Schubert et al., 2014
optic tectum cellular response to heat process quality, abnormal AB + MO1-stx1b + MO2-stx1b heat shock Fig. 4 from Schubert et al., 2014
optic tectum regulation of neuronal action potential decreased process quality, abnormal AB + MO1-stx1b + MO2-stx1b standard conditions Fig. 3,  Fig. 5 from Schubert et al., 2014
optic tectum regulation of neuronal action potential decreased process quality, abnormal AB + MO1-stx1b + MO2-stx1b chemical treatment: double-stranded DNA fragment Fig. 5 from Schubert et al., 2014
optic tectum neuronal action potential irregular rhythm, abnormal AB + MO1-stx1b + MO2-stx1b heat shock Fig. 4 from Schubert et al., 2014
optic tectum neuronal action potential irregular rhythm, abnormal AB + MO1-stx1b + MO2-stx1b chemical treatment: double-stranded DNA fragment Fig. 5 from Schubert et al., 2014
optic tectum neuronal action potential increased frequency, abnormal AB + MO1-stx1b + MO2-stx1b standard conditions Fig. 3,  Fig. 5 from Schubert et al., 2014
brain fosab expression increased amount, abnormal AB + MO2-stx1b chemical treatment by environment: pentetrazol Fig. 3 with image,  Fig. 6 with image from Zheng et al., 2018
whole organism Ab1-stx1b labeling amount, ameliorated AB + MO2-stx1b chemical treatment by environment: berberine, chemical treatment by environment: pentetrazol Fig. 8 from Zheng et al., 2018
locomotory behavior increased process quality, abnormal AB + MO2-stx1b chemical treatment by environment: berberine, chemical treatment by environment: pentetrazol Fig. 6 with image from Zheng et al., 2018
brain stx1b expression decreased amount, abnormal AB + MO2-stx1b chemical treatment by environment: berberine, chemical treatment by environment: pentetrazol Fig. 7 with image from Zheng et al., 2018
whole organism Ab1-stx1b labeling decreased amount, abnormal AB + MO2-stx1b control Fig. 3 with image,  Fig. 7 with image from Zheng et al., 2018
whole organism Ab1-stx1b labeling decreased amount, abnormal AB + MO2-stx1b chemical treatment by environment: pentetrazol Fig. 3 with image,  Fig. 7 with image,  Fig. 8 from Zheng et al., 2018
locomotory behavior increased process quality, abnormal AB + MO2-stx1b chemical treatment by environment: pentetrazol Fig. 3 with image,  Fig. 6 with image,  Fig. 8 from Zheng et al., 2018
brain stx1b expression decreased amount, abnormal AB + MO2-stx1b chemical treatment by environment: pentetrazol Fig. 3 with image,  Fig. 7 with image from Zheng et al., 2018
brain stx1b expression decreased amount, abnormal AB + MO2-stx1b control Fig. 3 with image,  Fig. 7 with image from Zheng et al., 2018
whole organism Ab1-stx1b labeling decreased amount, abnormal AB + MO2-stx1b chemical treatment by environment: berberine, chemical treatment by environment: pentetrazol Fig. 7 with image from Zheng et al., 2018
locomotory behavior occurrence, ameliorated AB + MO2-stx1b chemical treatment by environment: berberine, chemical treatment by environment: pentetrazol Fig. 8 from Zheng et al., 2018
locomotory behavior process quality, ameliorated AB + MO2-stx1b chemical treatment by environment: berberine, chemical treatment by environment: pentetrazol Fig. 8 from Zheng et al., 2018
brain fosab expression amount, ameliorated AB + MO2-stx1b chemical treatment by environment: berberine, chemical treatment by environment: pentetrazol Fig. 6 with image from Zheng et al., 2018
locomotory behavior increased occurrence, abnormal AB + MO2-stx1b chemical treatment by environment: berberine, chemical treatment by environment: pentetrazol Fig. 6 with image from Zheng et al., 2018
locomotory behavior increased occurrence, abnormal AB + MO2-stx1b chemical treatment by environment: pentetrazol Fig. 3 with image,  Fig. 6 with image,  Fig. 8 from Zheng et al., 2018
Citations
TSV
1 - 2 of 2
Show
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.