Morpholino

MO2-stx1b

ID
ZDB-MRPHLNO-150212-9
Name
MO2-stx1b
Previous Names
None
Target
Sequence
5' - AAATATCTCTTGAGATGTCCGCTGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO, targets the 5'UTR.
Genome Resources
None
Target Location
Genome Build: GRCz11Chromosome: 19
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-stx1b
Expressed Gene Anatomy Figures
fosab Fig. 3 with imageFig. 6 with image from Zheng et al., 2018
stx1b Fig. 3 with imageFig. 7 with image from Zheng et al., 2018
Phenotype
Phenotype resulting from MO2-stx1b
Phenotype of all Fish created by or utilizing MO2-stx1b
Phenotype Fish Conditions Figures
optic tectum neuronal action potential increased frequency, abnormal AB + MO1-stx1b + MO2-stx1b heat shock Fig. 4 from Schubert et al., 2014
optic tectum neuronal action potential irregular rhythm, abnormal AB + MO1-stx1b + MO2-stx1b standard conditions Fig. 3Fig. 5 from Schubert et al., 2014
musculoskeletal movement irregular rhythm, abnormal AB + MO1-stx1b + MO2-stx1b standard conditions text only from Schubert et al., 2014
optic tectum regulation of neuronal action potential decreased process quality, abnormal AB + MO1-stx1b + MO2-stx1b heat shock Fig. 4 from Schubert et al., 2014
musculoskeletal movement decreased coordination, abnormal AB + MO1-stx1b + MO2-stx1b standard conditions text only from Schubert et al., 2014
optic tectum neuronal action potential increased frequency, abnormal AB + MO1-stx1b + MO2-stx1b chemical treatment: double-stranded DNA fragment Fig. 5 from Schubert et al., 2014
thigmotaxis decreased occurrence, abnormal AB + MO1-stx1b + MO2-stx1b standard conditions text only from Schubert et al., 2014
musculoskeletal movement episodic, abnormal AB + MO1-stx1b + MO2-stx1b standard conditions text only from Schubert et al., 2014
optic tectum cellular response to heat process quality, abnormal AB + MO1-stx1b + MO2-stx1b heat shock Fig. 4 from Schubert et al., 2014
optic tectum regulation of neuronal action potential decreased process quality, abnormal AB + MO1-stx1b + MO2-stx1b standard conditions Fig. 3Fig. 5 from Schubert et al., 2014
optic tectum regulation of neuronal action potential decreased process quality, abnormal AB + MO1-stx1b + MO2-stx1b chemical treatment: double-stranded DNA fragment Fig. 5 from Schubert et al., 2014
optic tectum neuronal action potential irregular rhythm, abnormal AB + MO1-stx1b + MO2-stx1b heat shock Fig. 4 from Schubert et al., 2014
optic tectum neuronal action potential irregular rhythm, abnormal AB + MO1-stx1b + MO2-stx1b chemical treatment: double-stranded DNA fragment Fig. 5 from Schubert et al., 2014
optic tectum neuronal action potential increased frequency, abnormal AB + MO1-stx1b + MO2-stx1b standard conditions Fig. 3Fig. 5 from Schubert et al., 2014
brain fosab expression increased amount, abnormal AB + MO2-stx1b chemical treatment by environment: pentetrazol Fig. 3 with imageFig. 6 with image from Zheng et al., 2018
whole organism Ab1-stx1b labeling amount, ameliorated AB + MO2-stx1b chemical treatment by environment: berberine, chemical treatment by environment: pentetrazol Fig. 8 from Zheng et al., 2018
locomotory behavior increased process quality, abnormal AB + MO2-stx1b chemical treatment by environment: berberine, chemical treatment by environment: pentetrazol Fig. 6 with image from Zheng et al., 2018
brain stx1b expression decreased amount, abnormal AB + MO2-stx1b chemical treatment by environment: berberine, chemical treatment by environment: pentetrazol Fig. 7 with image from Zheng et al., 2018
whole organism Ab1-stx1b labeling decreased amount, abnormal AB + MO2-stx1b control Fig. 3 with imageFig. 7 with image from Zheng et al., 2018
whole organism Ab1-stx1b labeling decreased amount, abnormal AB + MO2-stx1b chemical treatment by environment: pentetrazol Fig. 3 with imageFig. 7 with imageFig. 8 from Zheng et al., 2018
locomotory behavior increased process quality, abnormal AB + MO2-stx1b chemical treatment by environment: pentetrazol Fig. 3 with imageFig. 6 with imageFig. 8 from Zheng et al., 2018
brain stx1b expression decreased amount, abnormal AB + MO2-stx1b chemical treatment by environment: pentetrazol Fig. 3 with imageFig. 7 with image from Zheng et al., 2018
brain stx1b expression decreased amount, abnormal AB + MO2-stx1b control Fig. 3 with imageFig. 7 with image from Zheng et al., 2018
whole organism Ab1-stx1b labeling decreased amount, abnormal AB + MO2-stx1b chemical treatment by environment: berberine, chemical treatment by environment: pentetrazol Fig. 7 with image from Zheng et al., 2018
locomotory behavior occurrence, ameliorated AB + MO2-stx1b chemical treatment by environment: berberine, chemical treatment by environment: pentetrazol Fig. 8 from Zheng et al., 2018
locomotory behavior process quality, ameliorated AB + MO2-stx1b chemical treatment by environment: berberine, chemical treatment by environment: pentetrazol Fig. 8 from Zheng et al., 2018
brain fosab expression amount, ameliorated AB + MO2-stx1b chemical treatment by environment: berberine, chemical treatment by environment: pentetrazol Fig. 6 with image from Zheng et al., 2018
locomotory behavior increased occurrence, abnormal AB + MO2-stx1b chemical treatment by environment: berberine, chemical treatment by environment: pentetrazol Fig. 6 with image from Zheng et al., 2018
locomotory behavior increased occurrence, abnormal AB + MO2-stx1b chemical treatment by environment: pentetrazol Fig. 3 with imageFig. 6 with imageFig. 8 from Zheng et al., 2018
Citations