Morpholino

MO1-stx1b

ID

ZDB-MRPHLNO-150212-8

Name

MO1-stx1b

Previous Names

None

Target

stx1b (1)

Sequence

5' - GTGCGATCCTTCATTTTTCCCCGCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-stx1b

Expressed Gene	Anatomy	Figures
fosab	brain	Fig. 3 , Fig. 6 from Zheng et al., 2018
stx1b	brain	Fig. 3 , Fig. 7 from Zheng et al., 2018

Phenotype

Phenotype resulting from MO1-stx1b

Phenotype	Fish	Figures
brain stx1b expression decreased amount, abnormal	AB + MO1-stx1b	Fig. 3 , Fig. 7 from Zheng et al., 2018
whole organism Ab1-stx1b labeling decreased amount, abnormal	AB + MO1-stx1b	Fig. 3 , Fig. 7 from Zheng et al., 2018

Phenotype of all Fish created by or utilizing MO1-stx1b

Phenotype	Fish	Conditions	Figures
whole organism Ab1-stx1b labeling amount, ameliorated	AB + MO1-stx1b	chemical treatment by environment: berberine, chemical treatment by environment: pentetrazol	Fig. 8 from Zheng et al., 2018
brain fosab expression increased amount, abnormal	AB + MO1-stx1b	chemical treatment by environment: pentetrazol	Fig. 3 , Fig. 6 from Zheng et al., 2018
whole organism Ab1-stx1b labeling decreased amount, abnormal	AB + MO1-stx1b	chemical treatment by environment: berberine, chemical treatment by environment: pentetrazol	Fig. 7 from Zheng et al., 2018
brain stx1b expression decreased amount, abnormal	AB + MO1-stx1b	chemical treatment by environment: berberine, chemical treatment by environment: pentetrazol	Fig. 7 from Zheng et al., 2018
whole organism Ab1-stx1b labeling decreased amount, abnormal	AB + MO1-stx1b	control	Fig. 3 , Fig. 7 from Zheng et al., 2018
locomotory behavior occurrence, ameliorated	AB + MO1-stx1b	chemical treatment by environment: berberine, chemical treatment by environment: pentetrazol	Fig. 8 from Zheng et al., 2018
locomotory behavior increased occurrence, abnormal	AB + MO1-stx1b	chemical treatment by environment: pentetrazol	Fig. 3 , Fig. 6 , Fig. 8 from Zheng et al., 2018
locomotory behavior increased occurrence, abnormal	AB + MO1-stx1b	chemical treatment by environment: berberine, chemical treatment by environment: pentetrazol	Fig. 6 from Zheng et al., 2018
brain fosab expression amount, ameliorated	AB + MO1-stx1b	chemical treatment by environment: berberine, chemical treatment by environment: pentetrazol	Fig. 6 from Zheng et al., 2018
locomotory behavior process quality, ameliorated	AB + MO1-stx1b	chemical treatment by environment: berberine, chemical treatment by environment: pentetrazol	Fig. 8 from Zheng et al., 2018
brain stx1b expression decreased amount, abnormal	AB + MO1-stx1b	chemical treatment by environment: pentetrazol	Fig. 3 , Fig. 7 from Zheng et al., 2018
locomotory behavior increased process quality, abnormal	AB + MO1-stx1b	chemical treatment by environment: pentetrazol	Fig. 3 , Fig. 6 , Fig. 8 from Zheng et al., 2018
whole organism Ab1-stx1b labeling decreased amount, abnormal	AB + MO1-stx1b	chemical treatment by environment: pentetrazol	Fig. 3 , Fig. 7 , Fig. 8 from Zheng et al., 2018
brain stx1b expression decreased amount, abnormal	AB + MO1-stx1b	control	Fig. 3 , Fig. 7 from Zheng et al., 2018
locomotory behavior increased process quality, abnormal	AB + MO1-stx1b	chemical treatment by environment: berberine, chemical treatment by environment: pentetrazol	Fig. 6 from Zheng et al., 2018
optic tectum neuronal action potential increased frequency, abnormal	AB + MO1-stx1b + MO2-stx1b	heat shock	Fig. 4 from Schubert et al., 2014
optic tectum neuronal action potential irregular rhythm, abnormal	AB + MO1-stx1b + MO2-stx1b	standard conditions	Fig. 3, Fig. 5 from Schubert et al., 2014
musculoskeletal movement irregular rhythm, abnormal	AB + MO1-stx1b + MO2-stx1b	standard conditions	text only from Schubert et al., 2014
optic tectum regulation of neuronal action potential decreased process quality, abnormal	AB + MO1-stx1b + MO2-stx1b	heat shock	Fig. 4 from Schubert et al., 2014
musculoskeletal movement decreased coordination, abnormal	AB + MO1-stx1b + MO2-stx1b	standard conditions	text only from Schubert et al., 2014
optic tectum neuronal action potential increased frequency, abnormal	AB + MO1-stx1b + MO2-stx1b	chemical treatment: double-stranded DNA fragment	Fig. 5 from Schubert et al., 2014
thigmotaxis decreased occurrence, abnormal	AB + MO1-stx1b + MO2-stx1b	standard conditions	text only from Schubert et al., 2014
musculoskeletal movement episodic, abnormal	AB + MO1-stx1b + MO2-stx1b	standard conditions	text only from Schubert et al., 2014
optic tectum cellular response to heat process quality, abnormal	AB + MO1-stx1b + MO2-stx1b	heat shock	Fig. 4 from Schubert et al., 2014
optic tectum regulation of neuronal action potential decreased process quality, abnormal	AB + MO1-stx1b + MO2-stx1b	standard conditions	Fig. 3, Fig. 5 from Schubert et al., 2014
optic tectum regulation of neuronal action potential decreased process quality, abnormal	AB + MO1-stx1b + MO2-stx1b	chemical treatment: double-stranded DNA fragment	Fig. 5 from Schubert et al., 2014
optic tectum neuronal action potential irregular rhythm, abnormal	AB + MO1-stx1b + MO2-stx1b	heat shock	Fig. 4 from Schubert et al., 2014
optic tectum neuronal action potential irregular rhythm, abnormal	AB + MO1-stx1b + MO2-stx1b	chemical treatment: double-stranded DNA fragment	Fig. 5 from Schubert et al., 2014
optic tectum neuronal action potential increased frequency, abnormal	AB + MO1-stx1b + MO2-stx1b	standard conditions	Fig. 3, Fig. 5 from Schubert et al., 2014

Citations