Morpholino

MO1-cdon

ID
ZDB-MRPHLNO-141021-1
Name
MO1-cdon
Previous Names
  • ATG (1)
Target
Sequence
5' - ATAATCTCAGGCCACCGTCCTCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cdon
No data available
Phenotype
Phenotype resulting from MO1-cdon
Phenotype Fish Figures
forerunner cell group sox17 expression spatial pattern, abnormal AB + MO1-cdon Fig. 3 with image from Deng et al., 2024
forerunner cell group sox32 expression spatial pattern, abnormal AB + MO1-cdon Fig. 3 with image from Deng et al., 2024
forerunner cell group GFP expression spatial pattern, abnormal s870Tg + MO1-cdon (AB) Fig. 3 with image from Deng et al., 2024
forerunner cell group cell decreased amount, abnormal s870Tg + MO1-cdon (AB) Fig. 3 with image from Deng et al., 2024
heart EGFP expression spatial pattern, abnormal twu34Tg + MO1-cdon (AB) Fig. 1 with imageFig. 6 with image from Deng et al., 2024
heart myl7 expression spatial pattern, abnormal twu34Tg + MO1-cdon (AB) Fig. 1 with imageFig. 6 with image from Deng et al., 2024
heart determination of heart left/right asymmetry process quality, abnormal twu34Tg + MO1-cdon (AB) Fig. 1 with image from Deng et al., 2024
heart looping decreased process quality, abnormal twu34Tg + MO1-cdon (AB) Fig. 1 with image from Deng et al., 2024
heart primordium lft2 expression spatial pattern, abnormal AB + MO1-cdon Fig. 2 with imageFig. 6 with image from Deng et al., 2024
heart primordium lft1 expression spatial pattern, abnormal AB + MO1-cdon Fig. 2 with imageFig. 6 with image from Deng et al., 2024
Kupffer's vesicle epithelial cell decreased amount, abnormal s870Tg + MO1-cdon (AB) Fig. 3 with image from Deng et al., 2024
Kupffer's vesicle epithelial cell GFP expression decreased distribution, abnormal s870Tg + MO1-cdon (AB) Fig. 3 with image from Deng et al., 2024
Kupffer's vesicle lumen decreased area, abnormal AB + MO1-cdon Fig. 3 with image from Deng et al., 2024
Kupffer's vesicle motile cilium decreased amount, abnormal AB + MO1-cdon Fig. 3 with image from Deng et al., 2024
Kupffer's vesicle motile cilium ab1-tuba labeling decreased distribution, abnormal AB + MO1-cdon Fig. 3 with image from Deng et al., 2024
Kupffer's vesicle motile cilium decreased length, abnormal AB + MO1-cdon Fig. 3 with image from Deng et al., 2024
Kupffer's vesicle motile cilium ab1-tuba labeling spatial pattern, abnormal AB + MO1-cdon Fig. 3 with image from Deng et al., 2024
lateral plate mesoderm spaw expression spatial pattern, abnormal AB + MO1-cdon Fig. 2 with imageFig. 6 with image from Deng et al., 2024
lateral plate mesoderm right side spaw expression mislocalised, abnormal AB + MO1-cdon Fig. 2 with imageFig. 6 with image from Deng et al., 2024
liver fabp10a expression spatial pattern, abnormal as3Tg + MO1-cdon (AB) Fig. 1 with imageFig. 6 with image from Deng et al., 2024
liver EGFP expression spatial pattern, abnormal as3Tg + MO1-cdon (AB) Fig. 1 with imageFig. 6 with image from Deng et al., 2024
liver determination of liver left/right asymmetry process quality, abnormal as3Tg + MO1-cdon (AB) Fig. 1 with image from Deng et al., 2024
optic fissure closure incomplete, abnormal WT + MO1-cdon Fig. S2 with image from Cardozo et al., 2014
Phenotype of all Fish created by or utilizing MO1-cdon
Phenotype Fish Conditions Figures
heart primordium lft1 expression spatial pattern, abnormal AB + MO1-cdon control Fig. 2 with imageFig. 6 with image from Deng et al., 2024
heart primordium lft2 expression spatial pattern, abnormal AB + MO1-cdon control Fig. 2 with imageFig. 6 with image from Deng et al., 2024
Kupffer's vesicle motile cilium ab1-tuba labeling spatial pattern, abnormal AB + MO1-cdon control Fig. 3 with image from Deng et al., 2024
forerunner cell group sox32 expression spatial pattern, abnormal AB + MO1-cdon control Fig. 3 with image from Deng et al., 2024
Kupffer's vesicle lumen decreased area, abnormal AB + MO1-cdon control Fig. 3 with image from Deng et al., 2024
Kupffer's vesicle motile cilium ab1-tuba labeling decreased distribution, abnormal AB + MO1-cdon control Fig. 3 with image from Deng et al., 2024
Kupffer's vesicle motile cilium decreased amount, abnormal AB + MO1-cdon control Fig. 3 with image from Deng et al., 2024
lateral plate mesoderm spaw expression spatial pattern, abnormal AB + MO1-cdon control Fig. 2 with imageFig. 6 with image from Deng et al., 2024
lateral plate mesoderm right side spaw expression mislocalised, abnormal AB + MO1-cdon control Fig. 2 with imageFig. 6 with image from Deng et al., 2024
Kupffer's vesicle motile cilium decreased length, abnormal AB + MO1-cdon control Fig. 3 with image from Deng et al., 2024
forerunner cell group sox17 expression spatial pattern, abnormal AB + MO1-cdon control Fig. 3 with image from Deng et al., 2024
optic fissure closure incomplete, abnormal WT + MO1-cdon standard conditions Fig. S2 with image from Cardozo et al., 2014
liver EGFP expression spatial pattern, abnormal as3Tg + MO1-cdon (AB) control Fig. 1 with imageFig. 6 with image from Deng et al., 2024
liver determination of liver left/right asymmetry process quality, abnormal as3Tg + MO1-cdon (AB) control Fig. 1 with image from Deng et al., 2024
liver fabp10a expression spatial pattern, abnormal as3Tg + MO1-cdon (AB) control Fig. 1 with imageFig. 6 with image from Deng et al., 2024
Kupffer's vesicle epithelial cell decreased amount, abnormal s870Tg + MO1-cdon (AB) control Fig. 3 with image from Deng et al., 2024
Kupffer's vesicle epithelial cell GFP expression decreased distribution, abnormal s870Tg + MO1-cdon (AB) control Fig. 3 with image from Deng et al., 2024
forerunner cell group cell decreased amount, abnormal s870Tg + MO1-cdon (AB) control Fig. 3 with image from Deng et al., 2024
forerunner cell group GFP expression spatial pattern, abnormal s870Tg + MO1-cdon (AB) control Fig. 3 with image from Deng et al., 2024
heart looping decreased process quality, abnormal twu34Tg + MO1-cdon (AB) control Fig. 1 with image from Deng et al., 2024
heart determination of heart left/right asymmetry process quality, abnormal twu34Tg + MO1-cdon (AB) control Fig. 1 with image from Deng et al., 2024
heart myl7 expression spatial pattern, abnormal twu34Tg + MO1-cdon (AB) control Fig. 1 with imageFig. 6 with image from Deng et al., 2024
heart EGFP expression spatial pattern, abnormal twu34Tg + MO1-cdon (AB) control Fig. 1 with imageFig. 6 with image from Deng et al., 2024
Citations