Morpholino
MO2-c3b
- ID
- ZDB-MRPHLNO-140822-2
- Name
- MO2-c3b
- Previous Names
-
- MO-c3.7/8s (1)
- Targets
- Sequence
-
5' - TTCCGACTTACCGAGCTGATCTCT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-c3b
No data available
Phenotype
Phenotype resulting from MO2-c3b
No data available
Phenotype of all Fish created by or utilizing MO2-c3b
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| neutrophil migration increased occurrence, abnormal | i114Tg + MO2-c3b | standard conditions |
Fig. 6 |
Citations