Morpholino
MO2-neurod1
- ID
- ZDB-MRPHLNO-140811-4
- Name
- MO2-neurod1
- Previous Names
- None
- Target
- Sequence
-
5' - TTTCCTCGCTGTATGACTTCGTCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-neurod1
| Expressed Gene | Anatomy | Figures |
|---|---|---|
| gcga |
|
Fig. 5 
from Flasse et al., 2013 |
| ghrl |
Fig. 5
from Flasse et al., 2013 |
|
| ins |
Fig. 5
from Flasse et al., 2013 |
|
| sst2 |
Fig. 5
from Flasse et al., 2013 |
1 - 4 of 4
Phenotype
Phenotype resulting from MO2-neurod1
| Phenotype | Fish | Figures |
|---|---|---|
| endocrine pancreas development disrupted, abnormal | WT + MO2-neurod1 |
Fig. 5
from Flasse et al., 2013 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO2-neurod1
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| endocrine pancreas development disrupted, abnormal | WT + MO2-neurod1 | standard conditions |
Fig. 5
from Flasse et al., 2013 |
1 - 1 of 1
Citations
- Dalgin, G., Prince, V.E. (2015) Differential levels of Neurod establish zebrafish endocrine pancreas cell fates. Developmental Biology. 402(1):81-97
- Flasse, L.C., Pirson, J.L., Stern, D.G., Von Berg, V., Manfroid, I., Peers, B., and Voz, M.L. (2013) Ascl1b and Neurod1, instead of Neurog3, control pancreatic endocrine cell fate in zebrafish. BMC Biology. 11(1):78
1 - 2 of 2
Show