Morpholino

MO1-mettl3

ID
ZDB-MRPHLNO-140428-3
Name
MO1-mettl3
Previous Names
  • METTL3MO (1)
Target
Sequence
5' - GGATGTGACTCCATGTGTCCGACAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mettl3
Expressed Gene Anatomy Figures
gata1a Fig. 2 from Zhang et al., 2017
gsc Fig. S6 with image from Ping et al., 2014
myb Fig. 2 from Zhang et al., 2017
myod1 Fig. 4 with image from Ping et al., 2014
notch1a Fig. 3 from Zhang et al., 2017
rag1 Fig. 2 from Zhang et al., 2017
runx1 Fig. 3 from Zhang et al., 2017
spi1b Fig. 2 from Zhang et al., 2017
Phenotype
Phenotype resulting from MO1-mettl3
Phenotype Fish Figures
apoptotic process increased process quality, abnormal WT + MO1-mettl3 Fig. 2 with image from Ping et al., 2014
endothelial cell EGFP expression increased amount, abnormal jh11Tg; y1Tg + MO1-mettl3 Fig. 3 from Zhang et al., 2017
endothelial cell notch1a expression increased amount, abnormal TU + MO1-mettl3 Fig. 3 from Zhang et al., 2017
eye decreased size, abnormal WT + MO1-mettl3 Fig. 2 with image from Ping et al., 2014
head decreased size, abnormal WT + MO1-mettl3 Fig. 2 with image from Ping et al., 2014
notochord curved ventral, abnormal WT + MO1-mettl3 Fig. 2 with image from Ping et al., 2014
somite myod1 expression increased amount, abnormal WT + MO1-mettl3 Fig. 4 with image from Ping et al., 2014
thymus has fewer parts of type T cell, abnormal ioz1Tg; s896Tg + MO1-mettl3 Fig. 2 from Zhang et al., 2017
thymus lymphocyte EGFP expression decreased amount, abnormal ioz1Tg; s896Tg + MO1-mettl3 Fig. 2 from Zhang et al., 2017
ventral wall of dorsal aorta lacks parts or has fewer parts of type hematopoietic multipotent progenitor cell, abnormal ioz1Tg; s896Tg + MO1-mettl3 Fig. 2 from Zhang et al., 2017
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell spi1b expression decreased amount, abnormal TU + MO1-mettl3 Fig. 2 from Zhang et al., 2017
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell rag1 expression decreased amount, abnormal TU + MO1-mettl3 Fig. 2 from Zhang et al., 2017
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell gata1a expression decreased amount, abnormal TU + MO1-mettl3 Fig. 2 from Zhang et al., 2017
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell EGFP expression decreased amount, abnormal ioz1Tg; s896Tg + MO1-mettl3 Fig. 2 from Zhang et al., 2017
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell myb expression decreased amount, abnormal TU + MO1-mettl3 Fig. 2 from Zhang et al., 2017
ventricular system decreased size, abnormal WT + MO1-mettl3 Fig. 2 with image from Ping et al., 2014
whole organism runx1 expression decreased amount, abnormal TU + MO1-mettl3 Fig. 3 from Zhang et al., 2017
whole organism Ab3-notch1 labeling increased amount, abnormal TU + MO1-mettl3 Fig. 3 from Zhang et al., 2017
Phenotype of all Fish created by or utilizing MO1-mettl3
Phenotype Fish Conditions Figures
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell spi1b expression decreased amount, abnormal TU + MO1-mettl3 standard conditions Fig. 2 from Zhang et al., 2017
whole organism runx1 expression decreased amount, abnormal TU + MO1-mettl3 standard conditions Fig. 3 from Zhang et al., 2017
whole organism runx1 expression amount, ameliorated TU + MO1-mettl3 chemical treatment: LY-411575 Fig. 3 from Zhang et al., 2017
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell myb expression decreased amount, abnormal TU + MO1-mettl3 standard conditions Fig. 2 from Zhang et al., 2017
endothelial cell notch1a expression increased amount, abnormal TU + MO1-mettl3 standard conditions Fig. 3 from Zhang et al., 2017
whole organism notch1a expression increased amount, abnormal TU + MO1-mettl3 chemical treatment: actinomycin D Fig. 4 from Zhang et al., 2017
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell rag1 expression decreased amount, abnormal TU + MO1-mettl3 standard conditions Fig. 2 from Zhang et al., 2017
whole organism Ab3-notch1 labeling increased amount, abnormal TU + MO1-mettl3 standard conditions Fig. 3 from Zhang et al., 2017
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell gata1a expression decreased amount, abnormal TU + MO1-mettl3 standard conditions Fig. 2 from Zhang et al., 2017
notochord curved ventral, abnormal WT + MO1-mettl3 standard conditions Fig. 2 with image from Ping et al., 2014
somite myod1 expression increased amount, abnormal WT + MO1-mettl3 standard conditions Fig. 4 with image from Ping et al., 2014
head decreased size, abnormal WT + MO1-mettl3 standard conditions Fig. 2 with image from Ping et al., 2014
eye decreased size, abnormal WT + MO1-mettl3 standard conditions Fig. 2 with image from Ping et al., 2014
ventricular system decreased size, abnormal WT + MO1-mettl3 standard conditions Fig. 2 with image from Ping et al., 2014
apoptotic process increased process quality, abnormal WT + MO1-mettl3 standard conditions Fig. 2 with image from Ping et al., 2014
ventral wall of dorsal aorta lacks parts or has fewer parts of type hematopoietic multipotent progenitor cell, abnormal ioz1Tg; s896Tg + MO1-mettl3 standard conditions Fig. 2 from Zhang et al., 2017
thymus has fewer parts of type T cell, abnormal ioz1Tg; s896Tg + MO1-mettl3 standard conditions Fig. 2 from Zhang et al., 2017
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell EGFP expression decreased amount, abnormal ioz1Tg; s896Tg + MO1-mettl3 standard conditions Fig. 2 from Zhang et al., 2017
thymus lymphocyte EGFP expression decreased amount, abnormal ioz1Tg; s896Tg + MO1-mettl3 standard conditions Fig. 2 from Zhang et al., 2017
endothelial cell EGFP expression increased amount, abnormal jh11Tg; y1Tg + MO1-mettl3 standard conditions Fig. 3 from Zhang et al., 2017
whole organism runx1 expression amount, ameliorated TU + MO1-mettl3 + MO1-notch1a standard conditions Fig. 3 from Zhang et al., 2017
eye decreased size, abnormal WT + MO1-mettl3 + MO1-wtap standard conditions Fig. 2 with image from Ping et al., 2014
somite myod1 expression increased amount, abnormal WT + MO1-mettl3 + MO1-wtap standard conditions Fig. 4 with image from Ping et al., 2014
ventricular system decreased size, abnormal WT + MO1-mettl3 + MO1-wtap standard conditions Fig. 2 with image from Ping et al., 2014
notochord curved ventral, abnormal WT + MO1-mettl3 + MO1-wtap standard conditions Fig. 2 with image from Ping et al., 2014
head decreased size, abnormal WT + MO1-mettl3 + MO1-wtap standard conditions Fig. 2 with image from Ping et al., 2014
apoptotic process increased process quality, abnormal WT + MO1-mettl3 + MO1-wtap standard conditions Fig. 2 with image from Ping et al., 2014
ventral wall of dorsal aorta lacks parts or has fewer parts of type hematopoietic multipotent progenitor cell, abnormal s896Tg; zf169Tg + MO1-mettl3 standard conditions Fig. 2 from Zhang et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.