Morpholino

MO1-mettl3

ID
ZDB-MRPHLNO-140428-3
Name
MO1-mettl3
Previous Names
  • METTL3MO (1)
Target
Sequence
5' - GGATGTGACTCCATGTGTCCGACAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mettl3
No data available
Phenotype
Phenotype resulting from MO1-mettl3
Phenotype Fish Figures
apoptotic process increased process quality, abnormal WT + MO1-mettl3 Fig. 2 with image from Ping et al., 2014
endothelial cell EGFP expression increased amount, abnormal jh11Tg; y1Tg + MO1-mettl3 Fig. 3 from Zhang et al., 2017
endothelial cell notch1a expression increased amount, abnormal TU + MO1-mettl3 Fig. 3 from Zhang et al., 2017
eye decreased size, abnormal WT + MO1-mettl3 Fig. 2 with image from Ping et al., 2014
head decreased size, abnormal WT + MO1-mettl3 Fig. 2 with image from Ping et al., 2014
notochord curved ventral, abnormal WT + MO1-mettl3 Fig. 2 with image from Ping et al., 2014
somite myod1 expression increased amount, abnormal WT + MO1-mettl3 Fig. 4 with image from Ping et al., 2014
thymus has fewer parts of type T cell, abnormal ioz1Tg; s896Tg + MO1-mettl3 Fig. 2 from Zhang et al., 2017
thymus lymphocyte EGFP expression decreased amount, abnormal ioz1Tg; s896Tg + MO1-mettl3 Fig. 2 from Zhang et al., 2017
ventral wall of dorsal aorta lacks parts or has fewer parts of type hematopoietic multipotent progenitor cell, abnormal ioz1Tg; s896Tg + MO1-mettl3 Fig. 2 from Zhang et al., 2017
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell spi1b expression decreased amount, abnormal TU + MO1-mettl3 Fig. 2 from Zhang et al., 2017
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell rag1 expression decreased amount, abnormal TU + MO1-mettl3 Fig. 2 from Zhang et al., 2017
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell gata1a expression decreased amount, abnormal TU + MO1-mettl3 Fig. 2 from Zhang et al., 2017
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell EGFP expression decreased amount, abnormal ioz1Tg; s896Tg + MO1-mettl3 Fig. 2 from Zhang et al., 2017
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell myb expression decreased amount, abnormal TU + MO1-mettl3 Fig. 2 from Zhang et al., 2017
ventricular system decreased size, abnormal WT + MO1-mettl3 Fig. 2 with image from Ping et al., 2014
whole organism runx1 expression decreased amount, abnormal TU + MO1-mettl3 Fig. 3 from Zhang et al., 2017
whole organism Ab3-notch1 labeling increased amount, abnormal TU + MO1-mettl3 Fig. 3 from Zhang et al., 2017
Phenotype of all Fish created by or utilizing MO1-mettl3
Phenotype Fish Conditions Figures
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell spi1b expression decreased amount, abnormal TU + MO1-mettl3 standard conditions Fig. 2 from Zhang et al., 2017
whole organism runx1 expression decreased amount, abnormal TU + MO1-mettl3 standard conditions Fig. 3 from Zhang et al., 2017
whole organism runx1 expression amount, ameliorated TU + MO1-mettl3 chemical treatment: LY-411575 Fig. 3 from Zhang et al., 2017
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell myb expression decreased amount, abnormal TU + MO1-mettl3 standard conditions Fig. 2 from Zhang et al., 2017
endothelial cell notch1a expression increased amount, abnormal TU + MO1-mettl3 standard conditions Fig. 3 from Zhang et al., 2017
whole organism notch1a expression increased amount, abnormal TU + MO1-mettl3 chemical treatment: actinomycin D Fig. 4 from Zhang et al., 2017
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell rag1 expression decreased amount, abnormal TU + MO1-mettl3 standard conditions Fig. 2 from Zhang et al., 2017
whole organism Ab3-notch1 labeling increased amount, abnormal TU + MO1-mettl3 standard conditions Fig. 3 from Zhang et al., 2017
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell gata1a expression decreased amount, abnormal TU + MO1-mettl3 standard conditions Fig. 2 from Zhang et al., 2017
notochord curved ventral, abnormal WT + MO1-mettl3 standard conditions Fig. 2 with image from Ping et al., 2014
somite myod1 expression increased amount, abnormal WT + MO1-mettl3 standard conditions Fig. 4 with image from Ping et al., 2014
head decreased size, abnormal WT + MO1-mettl3 standard conditions Fig. 2 with image from Ping et al., 2014
eye decreased size, abnormal WT + MO1-mettl3 standard conditions Fig. 2 with image from Ping et al., 2014
ventricular system decreased size, abnormal WT + MO1-mettl3 standard conditions Fig. 2 with image from Ping et al., 2014
apoptotic process increased process quality, abnormal WT + MO1-mettl3 standard conditions Fig. 2 with image from Ping et al., 2014
ventral wall of dorsal aorta lacks parts or has fewer parts of type hematopoietic multipotent progenitor cell, abnormal ioz1Tg; s896Tg + MO1-mettl3 standard conditions Fig. 2 from Zhang et al., 2017
thymus has fewer parts of type T cell, abnormal ioz1Tg; s896Tg + MO1-mettl3 standard conditions Fig. 2 from Zhang et al., 2017
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell EGFP expression decreased amount, abnormal ioz1Tg; s896Tg + MO1-mettl3 standard conditions Fig. 2 from Zhang et al., 2017
thymus lymphocyte EGFP expression decreased amount, abnormal ioz1Tg; s896Tg + MO1-mettl3 standard conditions Fig. 2 from Zhang et al., 2017
endothelial cell EGFP expression increased amount, abnormal jh11Tg; y1Tg + MO1-mettl3 standard conditions Fig. 3 from Zhang et al., 2017
whole organism runx1 expression amount, ameliorated TU + MO1-mettl3 + MO1-notch1a standard conditions Fig. 3 from Zhang et al., 2017
eye decreased size, abnormal WT + MO1-mettl3 + MO1-wtap standard conditions Fig. 2 with image from Ping et al., 2014
somite myod1 expression increased amount, abnormal WT + MO1-mettl3 + MO1-wtap standard conditions Fig. 4 with image from Ping et al., 2014
ventricular system decreased size, abnormal WT + MO1-mettl3 + MO1-wtap standard conditions Fig. 2 with image from Ping et al., 2014
notochord curved ventral, abnormal WT + MO1-mettl3 + MO1-wtap standard conditions Fig. 2 with image from Ping et al., 2014
head decreased size, abnormal WT + MO1-mettl3 + MO1-wtap standard conditions Fig. 2 with image from Ping et al., 2014
apoptotic process increased process quality, abnormal WT + MO1-mettl3 + MO1-wtap standard conditions Fig. 2 with image from Ping et al., 2014
ventral wall of dorsal aorta lacks parts or has fewer parts of type hematopoietic multipotent progenitor cell, abnormal s896Tg; zf169Tg + MO1-mettl3 standard conditions Fig. 2 from Zhang et al., 2017
Citations