Morpholino
MO1-wtap
- ID
- ZDB-MRPHLNO-140428-2
- Name
- MO1-wtap
- Previous Names
- None
- Target
- Sequence
-
5' - AGGTTCTTCATTGGTCATTCTGATC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-wtap
Expressed Gene | Anatomy | Figures |
---|---|---|
gsc |
Fig. S6 ![]() |
|
myod1 |
Fig. 4 ![]() |
1 - 2 of 2
Phenotype
Phenotype resulting from MO1-wtap
1 - 5 of 6 Show all
Phenotype of all Fish created by or utilizing MO1-wtap
1 - 5 of 12 Show all
Citations
- Huang, L., Liang, H., Wang, S., Chen, S. (2021) m6A writer complex promotes timely differentiation and survival of retinal progenitor cells in zebrafish. Biochemical and Biophysical Research Communications. 567:171-176
- Ping, X.L., Sun, B.F., Wang, L., Xiao, W., Yang, X., Wang, W.J., Adhikari, S., Shi, Y., Lv, Y., Chen, Y.S., Zhao, X., Li, A., Yang, Y., Dahal, U., Lou, X.M., Liu, X., Huang, J., Yuan, W.P., Zhu, X.F., Cheng, T., Zhao, Y.L., Wang, X., Rendtlew Danielsen, J.M., Liu, F., and Yang, Y.G. (2014) Mammalian WTAP is a regulatory subunit of the RNA N6-methyladenosine methyltransferase. Cell Research. 24(2):177-189
1 - 2 of 2
Show