Morpholino

MO1-chd2

ID

ZDB-MRPHLNO-140320-1

Name

MO1-chd2

Previous Names

E2I2 MO (1)

Target

chd2 (1)

Sequence

5' - GATCAGACTGGCCTTTTTGTGTACC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-chd2

No data available

Phenotype

Phenotype resulting from MO1-chd2

Phenotype	Fish	Figures
action potential initiation increased frequency, abnormal	WT + MO1-chd2	Fig. 2 from Melikishvili et al., 2024
cranial skeletal system development delayed, abnormal	WT + MO1-chd2	Fig. 2 from Melikishvili et al., 2024
embryo development disrupted, abnormal	WT + MO1-chd2	Fig. 2 from Suls et al., 2013
head decreased size, abnormal	WT + MO1-chd2	Fig. 2 from Melikishvili et al., 2024 Fig. 2 from Suls et al., 2013
neuronal action potential ictal, abnormal	WT + MO1-chd2	Fig. 3 from Suls et al., 2013
optic tectum transmission of nerve impulse process quality, abnormal	AB + MO1-chd2	Fig. 2, Fig. 3 from Galizia et al., 2015
pectoral fin development delayed, abnormal	WT + MO1-chd2	Fig. 2 from Melikishvili et al., 2024
pericardium edematous, abnormal	WT + MO1-chd2	Fig. 2 from Melikishvili et al., 2024 Fig. 2 from Suls et al., 2013
post-vent region curved, abnormal	WT + MO1-chd2	Fig. 2 from Melikishvili et al., 2024
post-vent region kinked, abnormal	WT + MO1-chd2	Fig. 2 from Melikishvili et al., 2024
swim bladder absent, abnormal	WT + MO1-chd2	Fig. 2 from Suls et al., 2013
swim bladder uninflated, abnormal	WT + MO1-chd2	Fig. 2 from Melikishvili et al., 2024
swimming process quality, abnormal	WT + MO1-chd2	text only from Suls et al., 2013
trunk increased curvature, abnormal	WT + MO1-chd2	Fig. 2 from Suls et al., 2013

Phenotype of all Fish created by or utilizing MO1-chd2

Phenotype	Fish	Conditions	Figures
optic tectum transmission of nerve impulse process quality, abnormal	AB + MO1-chd2	standard conditions	Fig. 2, Fig. 3 from Galizia et al., 2015
head decreased size, abnormal	WT + MO1-chd2	standard conditions	Fig. 2 from Melikishvili et al., 2024 Fig. 2 from Suls et al., 2013
swimming process quality, abnormal	WT + MO1-chd2	standard conditions	text only from Suls et al., 2013
embryo development disrupted, abnormal	WT + MO1-chd2	standard conditions	Fig. 2 from Suls et al., 2013
action potential initiation frequency, ameliorated	WT + MO1-chd2	chemical treatment by environment: acetazolamide	Fig. 2 from Melikishvili et al., 2024
post-vent region kinked, abnormal	WT + MO1-chd2	control	Fig. 2 from Melikishvili et al., 2024
swim bladder absent, abnormal	WT + MO1-chd2	standard conditions	Fig. 2 from Suls et al., 2013
pectoral fin development delayed, abnormal	WT + MO1-chd2	control	Fig. 2 from Melikishvili et al., 2024
neuronal action potential ictal, abnormal	WT + MO1-chd2	standard conditions	Fig. 3 from Suls et al., 2013
cranial skeletal system development delayed, abnormal	WT + MO1-chd2	control	Fig. 2 from Melikishvili et al., 2024
action potential initiation increased frequency, abnormal	WT + MO1-chd2	control	Fig. 2 from Melikishvili et al., 2024
action potential initiation increased frequency, abnormal	WT + MO1-chd2	chemical treatment by environment: fenfluramine	Fig. 2 from Melikishvili et al., 2024
trunk increased curvature, abnormal	WT + MO1-chd2	standard conditions	Fig. 2 from Suls et al., 2013
post-vent region curved, abnormal	WT + MO1-chd2	control	Fig. 2 from Melikishvili et al., 2024
pericardium edematous, abnormal	WT + MO1-chd2	standard conditions	Fig. 2 from Melikishvili et al., 2024 Fig. 2 from Suls et al., 2013
swim bladder uninflated, abnormal	WT + MO1-chd2	control	Fig. 2 from Melikishvili et al., 2024

Citations