header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-140224-4
Morpholino Name: MO1-snap25
Targets: snap25a (1), snap25b (1)
Previous Name: snap-25a,b MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AGCTGCTCTCCAACTGGCTCTTACT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: targeted to 5-prime UTR of snap25a, snap25b
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-snap25 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-snap25 No data available
PHENOTYPE
Phenotype resulting from MO1-snap25
No data available

Phenotype of all Fish created by or utilizing MO1-snap25
Phenotype Fish Conditions Figures
locomotion decreased process quality, abnormal WT + MO1-snap25 standard conditions text only from Fontenas et al., 2016
posterior lateral line nerve clustering of voltage-gated sodium channels decreased process quality, abnormal WT + MO1-snap25 standard conditions Fig. 6 with image from Fontenas et al., 2016
posterior lateral line nerve node of Ranvier decreased amount, abnormal WT + MO1-snap25 standard conditions Fig. 6 with image from Fontenas et al., 2016
thigmotaxis decreased process quality, abnormal WT + MO1-snap25 standard conditions text only from Fontenas et al., 2016
primary motor neuron axon extension decreased process quality, abnormal WT + MO1-snap25 + MO1-snap25a standard conditions Fig. 6 with image from Wei et al., 2013
musculoskeletal movement decreased occurrence, abnormal WT + MO1-snap25 + MO1-snap25a standard conditions Fig. 1 with image from Wei et al., 2013
secondary motor neuron axon extension decreased process quality, abnormal WT + MO1-snap25 + MO1-snap25a standard conditions Fig. S6 with image from Wei et al., 2013
whole organism SNARE complex decreased object quality, abnormal WT + MO1-snap25 + MO1-snap25a standard conditions Fig. 3 with image from Wei et al., 2013
primary motor neuron axon decreased branchiness, abnormal WT + MO1-snap25 + MO1-snap25a standard conditions Fig. 6 with image from Wei et al., 2013
secondary motor neuron axon decreased length, abnormal WT + MO1-snap25 + MO1-snap25a standard conditions Fig. S6 with image from Wei et al., 2013
motor neuron axon decreased length, abnormal vu504Tg + MO1-snap25 + MO1-snap25a standard conditions Fig. 5 with image from Wei et al., 2013
spinal cord motor neuron decreased branchiness, abnormal vu504Tg + MO1-snap25 + MO1-snap25a standard conditions Fig. 5 with image from Wei et al., 2013
motor neuron axon extension decreased process quality, abnormal vu504Tg + MO1-snap25 + MO1-snap25a standard conditions Fig. 5 with image from Wei et al., 2013
OTHER MO1-snap25 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)