Morpholino

MO1-snap25

ID
ZDB-MRPHLNO-140224-4
Name
MO1-snap25
Previous Names
  • snap-25a,b MO (1)
Targets
Sequence
5' - AGCTGCTCTCCAACTGGCTCTTACT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
targeted to 5-prime UTR of snap25a, snap25b
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-snap25
No data available
Phenotype
Phenotype resulting from MO1-snap25
No data available
Phenotype of all Fish created by or utilizing MO1-snap25
Phenotype Fish Conditions Figures
locomotion decreased process quality, abnormal WT + MO1-snap25 standard conditions text only from Fontenas et al., 2016
posterior lateral line nerve clustering of voltage-gated sodium channels decreased process quality, abnormal WT + MO1-snap25 standard conditions Fig. 6 with image from Fontenas et al., 2016
posterior lateral line nerve node of Ranvier decreased amount, abnormal WT + MO1-snap25 standard conditions Fig. 6 with image from Fontenas et al., 2016
thigmotaxis decreased process quality, abnormal WT + MO1-snap25 standard conditions text only from Fontenas et al., 2016
primary motor neuron axon extension decreased process quality, abnormal WT + MO1-snap25 + MO1-snap25a standard conditions Fig. 6 with image from Wei et al., 2013
musculoskeletal movement decreased occurrence, abnormal WT + MO1-snap25 + MO1-snap25a standard conditions Fig. 1 with image from Wei et al., 2013
secondary motor neuron axon extension decreased process quality, abnormal WT + MO1-snap25 + MO1-snap25a standard conditions Fig. S6 with image from Wei et al., 2013
whole organism SNARE complex decreased object quality, abnormal WT + MO1-snap25 + MO1-snap25a standard conditions Fig. 3 with image from Wei et al., 2013
secondary motor neuron axon decreased length, abnormal WT + MO1-snap25 + MO1-snap25a standard conditions Fig. S6 with image from Wei et al., 2013
primary motor neuron axon decreased branchiness, abnormal WT + MO1-snap25 + MO1-snap25a standard conditions Fig. 6 with image from Wei et al., 2013
motor neuron axon decreased length, abnormal vu504Tg + MO1-snap25 + MO1-snap25a standard conditions Fig. 5 with image from Wei et al., 2013
spinal cord motor neuron decreased branchiness, abnormal vu504Tg + MO1-snap25 + MO1-snap25a standard conditions Fig. 5 with image from Wei et al., 2013
motor neuron axon extension decreased process quality, abnormal vu504Tg + MO1-snap25 + MO1-snap25a standard conditions Fig. 5 with image from Wei et al., 2013
Citations