Morpholino

MO4-tbx2a

ID
ZDB-MRPHLNO-140123-2
Name
MO4-tbx2a
Previous Names
None
Target
Sequence
5' - GGAAACATTCTCCTATGGACGAAAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-tbx2a
Phenotype
Phenotype resulting from MO4-tbx2a
Phenotype Fish Figures
ball increased size, abnormal WT + MO4-tbx2a Fig. 2 with image from Thi Thu et al., 2013
corpuscles of Stannius tbx2b expression absent, abnormal TU + MO4-tbx2a Fig. 7 with image from Drummond et al., 2017
corpuscles of Stannius stc1 expression increased distribution, abnormal TU + MO4-tbx2a Fig. 4 with image from Drummond et al., 2017
corpuscles of Stannius sim1a expression increased distribution, abnormal TU + MO4-tbx2a Fig. 4 with image from Drummond et al., 2017
corpuscles of Stannius cell increased amount, abnormal TU + MO4-tbx2a Fig. 4 with image from Drummond et al., 2017
eye decreased size, abnormal WT + MO4-tbx2a Fig. 2 with image from Thi Thu et al., 2013
heart edematous, abnormal WT + MO4-tbx2a Fig. 2 with image from Thi Thu et al., 2013
inner ear decreased size, abnormal WT + MO4-tbx2a Fig. 2 with image from Thi Thu et al., 2013
pharyngeal arch arrested, abnormal WT + MO4-tbx2a Fig. 3 with image from Thi Thu et al., 2013
pharyngeal arch disorganized, abnormal WT + MO4-tbx2a + MO4-tp53 Fig. 3 with image from Thi Thu et al., 2013
pharyngeal arch malformed, abnormal WT + MO4-tbx2a + MO4-tp53 Fig. 2 with imageFig. 3 with image from Thi Thu et al., 2013
pharyngeal arch mesenchyme condensation cell fused with pharyngeal arch mesenchyme condensation cell, abnormal WT + MO4-tbx2a Fig. 3 with image from Thi Thu et al., 2013
pharyngeal arch 2 malformed, abnormal sqet331BEt + MO4-tbx2a Fig. 3 with image from Thi Thu et al., 2013
pharyngeal arch cartilage morphology, abnormal sqet331BEt + MO4-tbx2a Fig. 3 with image from Thi Thu et al., 2013
pharyngeal pouch arrested, abnormal WT + MO4-tbx2a Fig. 3 with image from Thi Thu et al., 2013
pharyngeal system development decreased process quality, abnormal WT + MO4-tbx2a Fig. 3 with image from Thi Thu et al., 2013
proctodeum malformed, abnormal WT + MO4-tbx2a Fig. 2 with image from Thi Thu et al., 2013
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal TU + MO4-tbx2a Fig. 3 with image from Drummond et al., 2017
pronephric distal late tubule decreased length, abnormal TU + MO4-tbx2a Fig. 3 with image from Drummond et al., 2017
pronephric proximal convoluted tubule slc20a1a expression increased distribution, abnormal TU + MO4-tbx2a Fig. 3 with image from Drummond et al., 2017
pronephric proximal convoluted tubule increased length, abnormal TU + MO4-tbx2a Fig. 3 with image from Drummond et al., 2017
pronephros posterior region tbx2b expression decreased distribution, abnormal TU + MO4-tbx2a Fig. 7 with image from Drummond et al., 2017
swim bladder inflation decreased process quality, abnormal WT + MO4-tbx2a Fig. 2 with image from Thi Thu et al., 2013
whole organism axis curved, abnormal WT + MO4-tbx2a Fig. 2 with image from Thi Thu et al., 2013
Phenotype of all Fish created by or utilizing MO4-tbx2a
Phenotype Fish Conditions Figures
corpuscles of Stannius tbx2b expression absent, abnormal TU + MO4-tbx2a standard conditions Fig. 7 with image from Drummond et al., 2017
corpuscles of Stannius sim1a expression increased distribution, abnormal TU + MO4-tbx2a standard conditions Fig. 4 with image from Drummond et al., 2017
corpuscles of Stannius cell increased amount, abnormal TU + MO4-tbx2a standard conditions Fig. 4 with image from Drummond et al., 2017
pronephric distal late tubule decreased length, abnormal TU + MO4-tbx2a standard conditions Fig. 3 with image from Drummond et al., 2017
pronephric proximal convoluted tubule increased length, abnormal TU + MO4-tbx2a standard conditions Fig. 3 with image from Drummond et al., 2017
pronephros posterior region tbx2b expression decreased distribution, abnormal TU + MO4-tbx2a standard conditions Fig. 7 with image from Drummond et al., 2017
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal TU + MO4-tbx2a standard conditions Fig. 3 with image from Drummond et al., 2017
pronephric proximal convoluted tubule slc20a1a expression increased distribution, abnormal TU + MO4-tbx2a standard conditions Fig. 3 with image from Drummond et al., 2017
corpuscles of Stannius stc1 expression increased distribution, abnormal TU + MO4-tbx2a standard conditions Fig. 4 with image from Drummond et al., 2017
swim bladder inflation decreased process quality, abnormal WT + MO4-tbx2a standard conditions Fig. 2 with image from Thi Thu et al., 2013
inner ear decreased size, abnormal WT + MO4-tbx2a standard conditions Fig. 2 with image from Thi Thu et al., 2013
pharyngeal system development decreased process quality, abnormal WT + MO4-tbx2a standard conditions Fig. 3 with image from Thi Thu et al., 2013
ball increased size, abnormal WT + MO4-tbx2a standard conditions Fig. 2 with image from Thi Thu et al., 2013
pharyngeal arch mesenchyme condensation cell fused with pharyngeal arch mesenchyme condensation cell, abnormal WT + MO4-tbx2a standard conditions Fig. 3 with image from Thi Thu et al., 2013
pharyngeal arch arrested, abnormal WT + MO4-tbx2a standard conditions Fig. 3 with image from Thi Thu et al., 2013
pharyngeal pouch arrested, abnormal WT + MO4-tbx2a standard conditions Fig. 3 with image from Thi Thu et al., 2013
pharyngeal arch malformed, abnormal WT + MO4-tbx2a standard conditions Fig. 2 with image from Thi Thu et al., 2013
whole organism axis curved, abnormal WT + MO4-tbx2a standard conditions Fig. 2 with image from Thi Thu et al., 2013
eye decreased size, abnormal WT + MO4-tbx2a standard conditions Fig. 2 with image from Thi Thu et al., 2013
heart edematous, abnormal WT + MO4-tbx2a standard conditions Fig. 2 with image from Thi Thu et al., 2013
proctodeum malformed, abnormal WT + MO4-tbx2a standard conditions Fig. 2 with image from Thi Thu et al., 2013
pharyngeal arch malformed, abnormal WT + MO4-tbx2a + MO4-tp53 standard conditions Fig. 3 with image from Thi Thu et al., 2013
pharyngeal arch disorganized, abnormal WT + MO4-tbx2a + MO4-tp53 standard conditions Fig. 3 with image from Thi Thu et al., 2013
pharyngeal arch 2 malformed, abnormal WT + MO4-tbx2a + MO4-tp53 standard conditions Fig. 3 with image from Thi Thu et al., 2013
pharyngeal arch cartilage morphology, abnormal sqet331BEt + MO4-tbx2a standard conditions Fig. 3 with image from Thi Thu et al., 2013
pharyngeal arch 2 malformed, abnormal sqet331BEt + MO4-tbx2a standard conditions Fig. 3 with image from Thi Thu et al., 2013
pronephric distal late tubule decreased length, abnormal tbx2bc144/c144 + MO4-tbx2a standard conditions Fig. 3 with image from Drummond et al., 2017
pronephric proximal convoluted tubule increased length, abnormal tbx2bc144/c144 + MO4-tbx2a standard conditions Fig. 3 with image from Drummond et al., 2017
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal tbx2bc144/c144 + MO4-tbx2a standard conditions Fig. 3 with image from Drummond et al., 2017
pronephric proximal convoluted tubule slc20a1a expression increased distribution, abnormal tbx2bc144/c144 + MO4-tbx2a standard conditions Fig. 3 with image from Drummond et al., 2017
Citations