Morpholino

MO2-utp4

ID
ZDB-MRPHLNO-140114-2
Name
MO2-utp4
Previous Names
  • IE14 (1)
  • MO2-cirh1a
Target
Sequence
5' - AAAACTCAAAAATCTGAGGTAAGAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-utp4
Expressed Gene Anatomy Figures
cdkn1a Fig. 6 with image from Wilkins et al., 2013
mdm2 Fig. 6 with image from Wilkins et al., 2013
tp53 Fig. 6 with image from Wilkins et al., 2013
Phenotype
Phenotype resulting from MO2-utp4
Phenotype Fish Figures
bile canaliculus decreased branchiness, abnormal WT + MO2-utp4 Fig. 5 with image from Wilkins et al., 2013
bile canaliculus decreased length, abnormal WT + MO2-utp4 Fig. 5 with image from Wilkins et al., 2013
bile canaliculus spheroid, abnormal WT + MO2-utp4 Fig. 5 with image from Wilkins et al., 2013
bile ductule sparse, abnormal WT + MO2-utp4 Fig. 5 with image from Wilkins et al., 2013
gall bladder lipid storage disrupted, abnormal TU + MO2-utp4 Fig. 4 with image,  Fig. 8 with image from Wilkins et al., 2013
hepaticobiliary system process disrupted, abnormal WT + MO2-utp4 Fig. 4 with image,  Fig. 8 with image from Wilkins et al., 2013
hepatocyte rough endoplasmic reticulum increased amount, abnormal WT + MO2-utp4 Fig. 3 with image from Wilkins et al., 2013
liver decreased size, abnormal WT + MO2-utp4 Fig. 3 with image from Wilkins et al., 2013
long-chain fatty acid metabolic process disrupted, abnormal WT + MO2-utp4 Fig. 4 with image,  Fig. 8 with image from Wilkins et al., 2013
yolk increased size, abnormal WT + MO2-utp4 Fig. 3 with image from Wilkins et al., 2013
Phenotype of all Fish created by or utilizing MO2-utp4
Phenotype Fish Conditions Figures
long-chain fatty acid metabolic process disrupted, abnormal TU + MO2-utp4 standard conditions Fig. 8 with image from Wilkins et al., 2013
gall bladder lipid storage disrupted, abnormal TU + MO2-utp4 standard conditions Fig. 8 with image from Wilkins et al., 2013
hepaticobiliary system process disrupted, abnormal TU + MO2-utp4 standard conditions Fig. 8 with image from Wilkins et al., 2013
hepatocyte rough endoplasmic reticulum increased amount, abnormal WT + MO2-utp4 standard conditions Fig. 3 with image from Wilkins et al., 2013
gall bladder lipid storage disrupted, abnormal WT + MO2-utp4 standard conditions Fig. 4 with image from Wilkins et al., 2013
bile canaliculus decreased length, abnormal WT + MO2-utp4 standard conditions Fig. 5 with image from Wilkins et al., 2013
yolk increased size, abnormal WT + MO2-utp4 standard conditions Fig. 3 with image from Wilkins et al., 2013
bile ductule sparse, abnormal WT + MO2-utp4 standard conditions Fig. 5 with image from Wilkins et al., 2013
bile canaliculus spheroid, abnormal WT + MO2-utp4 standard conditions Fig. 5 with image from Wilkins et al., 2013
hepaticobiliary system process disrupted, abnormal WT + MO2-utp4 standard conditions Fig. 4 with image from Wilkins et al., 2013
liver decreased size, abnormal WT + MO2-utp4 standard conditions Fig. 3 with image from Wilkins et al., 2013
bile canaliculus decreased branchiness, abnormal WT + MO2-utp4 standard conditions Fig. 5 with image from Wilkins et al., 2013
long-chain fatty acid metabolic process disrupted, abnormal WT + MO2-utp4 standard conditions Fig. 4 with image from Wilkins et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.