Morpholino

MO1-ppp1cbl

ID
ZDB-MRPHLNO-140102-2
Name
MO1-ppp1cbl
Previous Names
  • MO ppp1cbb (1)
Target
Sequence
5' - CTCCGCCATGACTGACTGACCGACT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ppp1cbl
No data available
Phenotype
Phenotype resulting from MO1-ppp1cbl
Phenotype of all Fish created by or utilizing MO1-ppp1cbl
Phenotype Fish Conditions Figures
axis elongation decreased process quality, abnormal WT + MO1-ppp1cbl standard conditions Fig. 2 with image from Jayashankar et al., 2013
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-ppp1cbl standard conditions Fig. 2 with image from Jayashankar et al., 2013
whole organism anterior-posterior axis shortened, abnormal WT + MO1-ppp1cbl standard conditions Fig. 2 with image from Jayashankar et al., 2013
whole organism anterior-posterior axis curved, abnormal WT + MO1-ppp1cbl standard conditions Fig. 2 with image from Jayashankar et al., 2013
segmental plate shortened, abnormal WT + MO1-ppp1cbl + MO2-ppp1cb standard conditions Fig. 8 with image from Jayashankar et al., 2013
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-ppp1cbl + MO2-ppp1cb standard conditions Fig. 2 with imageFig. 8 with image from Jayashankar et al., 2013
mesodermal cell has extra parts of type mesodermal cell bleb, abnormal WT + MO1-ppp1cbl + MO2-ppp1cb standard conditions Fig. 10 with image from Jayashankar et al., 2013
axis elongation decreased process quality, abnormal WT + MO1-ppp1cbl + MO2-ppp1cb standard conditions Fig. 2 with image from Jayashankar et al., 2013
notochord mesodermal cell positional polarity, abnormal WT + MO1-ppp1cbl + MO2-ppp1cb standard conditions Fig. 10 with image from Jayashankar et al., 2013
whole organism anterior-posterior axis shortened, abnormal WT + MO1-ppp1cbl + MO2-ppp1cb standard conditions Fig. 2 with imageFig. 8 with image from Jayashankar et al., 2013
segmental plate increased width, abnormal WT + MO1-ppp1cbl + MO2-ppp1cb standard conditions Fig. 8 with image from Jayashankar et al., 2013
whole organism anterior-posterior axis curved, abnormal WT + MO1-ppp1cbl + MO2-ppp1cb standard conditions Fig. 2 with image from Jayashankar et al., 2013
gastrulation process quality, abnormal WT + MO1-ppp1cbl + MO2-ppp1cb standard conditions Fig. 8 with image from Jayashankar et al., 2013
notochord shortened, abnormal WT + MO1-ppp1cbl + MO2-ppp1cb standard conditions Fig. 8 with image from Jayashankar et al., 2013
notochord increased width, abnormal WT + MO1-ppp1cbl + MO2-ppp1cb standard conditions Fig. 8 with image from Jayashankar et al., 2013
segmental plate mesodermal cell positional polarity, abnormal WT + MO1-ppp1cbl + MO2-ppp1cb standard conditions Fig. 10 with image from Jayashankar et al., 2013
gastrulation process quality, abnormal WT + MO1-ppp1cbl + MO2-ppp1cb + MO3-ppp1r12a standard conditions Fig. 9 with image from Jayashankar et al., 2013
axis elongation decreased process quality, abnormal WT + MO1-ppp1cbl + MO2-ppp1cb + MO3-ppp1r12a standard conditions Fig. 9 with image from Jayashankar et al., 2013
whole organism anterior-posterior axis shortened, abnormal WT + MO1-ppp1cbl + MO2-ppp1cb + MO3-ppp1r12a standard conditions Fig. 9 with image from Jayashankar et al., 2013
Citations