Morpholino

MO1-ddc

ID

ZDB-MRPHLNO-131018-4

Name

MO1-ddc

Previous Names

ddc tMO1 (1)

Target

ddc (1)

Sequence

5' - TCTCCGAAACTCTGCGGCATCCATC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-ddc

Expressed Gene	Anatomy	Figures
th	diencephalon dopaminergic neuron locus coeruleus dopaminergic neuron (not) olfactory bulb dopaminergic neuron (not) pretectum dopaminergic neuron	Fig. 6 from Shih et al., 2013

Phenotype

Phenotype resulting from MO1-ddc

Phenotype	Fish	Figures
apoptotic process increased occurrence, abnormal	AB/TU + MO1-ddc	Fig. 5 from Shih et al., 2013
brain apoptotic, abnormal	AB/TU + MO1-ddc	Fig. 5 from Shih et al., 2013
brain decreased volume, abnormal	AB/TU + MO1-ddc	Fig. 4 from Shih et al., 2013
brain has fewer parts of type cell, abnormal	AB/TU + MO1-ddc	Fig. 4 from Shih et al., 2013
brain development disrupted, abnormal	AB/TU + MO1-ddc	Fig. 4 from Shih et al., 2013
diencephalon dopaminergic neuron spatial pattern, abnormal	AB/TU + MO1-ddc	Fig. 6 from Shih et al., 2013
dopaminergic neuron decreased amount, abnormal	AB/TU + MO1-ddc	Fig. 6 from Shih et al., 2013
musculoskeletal movement, spinal reflex action disrupted, abnormal	AB/TU + MO1-ddc	Fig. 4 from Shih et al., 2013
optokinetic behavior disrupted, abnormal	AB/TU + MO1-ddc	Fig. 9 from Shih et al., 2013
swimming decreased speed, abnormal	AB/TU + MO1-ddc	Fig. 8 from Shih et al., 2013
swimming behavior disrupted, abnormal	AB/TU + MO1-ddc	Fig. 8 from Shih et al., 2013
thigmotaxis disrupted, abnormal	AB/TU + MO1-ddc	Fig. 4 from Shih et al., 2013
trunk apoptotic, abnormal	AB/TU + MO1-ddc	Fig. 5 from Shih et al., 2013
whole organism decreased length, abnormal	AB/TU + MO1-ddc	Fig. 4 from Shih et al., 2013

Phenotype of all Fish created by or utilizing MO1-ddc

Phenotype	Fish	Conditions	Figures
brain has fewer parts of type cell, abnormal	AB/TU + MO1-ddc	standard conditions	Fig. 4 from Shih et al., 2013
musculoskeletal movement, spinal reflex action disrupted, abnormal	AB/TU + MO1-ddc	standard conditions	Fig. 4 from Shih et al., 2013
swimming decreased speed, abnormal	AB/TU + MO1-ddc	standard conditions	Fig. 8 from Shih et al., 2013
swimming behavior disrupted, abnormal	AB/TU + MO1-ddc	standard conditions	Fig. 8 from Shih et al., 2013
brain apoptotic, abnormal	AB/TU + MO1-ddc	standard conditions	Fig. 5 from Shih et al., 2013
whole organism decreased length, abnormal	AB/TU + MO1-ddc	standard conditions	Fig. 4 from Shih et al., 2013
trunk apoptotic, abnormal	AB/TU + MO1-ddc	standard conditions	Fig. 5 from Shih et al., 2013
apoptotic process increased occurrence, abnormal	AB/TU + MO1-ddc	standard conditions	Fig. 5 from Shih et al., 2013
thigmotaxis disrupted, abnormal	AB/TU + MO1-ddc	standard conditions	Fig. 4 from Shih et al., 2013
brain decreased volume, abnormal	AB/TU + MO1-ddc	standard conditions	Fig. 4 from Shih et al., 2013
optokinetic behavior disrupted, abnormal	AB/TU + MO1-ddc	standard conditions	Fig. 9 from Shih et al., 2013
brain development disrupted, abnormal	AB/TU + MO1-ddc	standard conditions	Fig. 4 from Shih et al., 2013
diencephalon dopaminergic neuron spatial pattern, abnormal	AB/TU + MO1-ddc	standard conditions	Fig. 6 from Shih et al., 2013
dopaminergic neuron decreased amount, abnormal	AB/TU + MO1-ddc	standard conditions	Fig. 6 from Shih et al., 2013

Citations