Morpholino

MO3-spast

ID
ZDB-MRPHLNO-131010-1
Name
MO3-spast
Previous Names
None
Target
Sequence
5' - ATTCATTCACCCTTCTCGGGCTCTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-spast
No data available
Phenotype
Phenotype resulting from MO3-spast
Phenotype of all Fish created by or utilizing MO3-spast
Phenotype Fish Conditions Figures
whole organism decreased mobility, abnormal AB + MO3-spast standard conditions Fig. 8 from Allison et al., 2013
spinal cord motor neuron truncated, abnormal AB + MO3-spast standard conditions Fig. 8 from Allison et al., 2013
axon extension disrupted, abnormal AB + MO3-spast standard conditions Fig. 8 from Allison et al., 2013
spinal cord motor neuron branchiness, abnormal AB + MO3-spast standard conditions Fig. 8 from Allison et al., 2013
whole organism increased curvature, abnormal AB + MO3-spast standard conditions Fig. 8 from Allison et al., 2013
whole organism arched, abnormal WT + MO3-spast standard conditions Fig. 9 from Julien et al., 2016
secondary motor neuron axon guidance process quality, abnormal WT + MO3-spast control Fig. 6 with image from Jardin et al., 2018
head hydrocephalic, ameliorated WT + MO3-spast chemical treatment: phenazine Fig. 9 from Julien et al., 2016
spinal cord microtubule cytoskeleton organization disrupted, ameliorated WT + MO3-spast chemical treatment: phenazine Fig. 9 from Julien et al., 2016
whole organism arched, ameliorated WT + MO3-spast chemical treatment: phenazine Fig. 9 from Julien et al., 2016
extension morphology, ameliorated WT + MO3-spast chemical treatment: methylene blue Fig. 9 from Julien et al., 2016
head hydrocephalic, ameliorated WT + MO3-spast chemical treatment: methylene blue Fig. 9 from Julien et al., 2016
head hydrocephalic, ameliorated WT + MO3-spast chemical treatment: Guanabenz Fig. 9 from Julien et al., 2016
reactive oxygen species metabolic process process quality, ameliorated WT + MO3-spast chemical treatment: salubrinal Fig. 9 from Julien et al., 2016
spinal cord microtubule cytoskeleton organization disrupted, ameliorated WT + MO3-spast chemical treatment: methylene blue Fig. 9 from Julien et al., 2016
caudal fin curved, abnormal WT + MO3-spast control Fig. 2 with image from Jardin et al., 2018
motor neuron axon microtubule bundle decreased diameter, abnormal WT + MO3-spast standard conditions Fig. 9 from Julien et al., 2016
extension morphology, ameliorated WT + MO3-spast chemical treatment: salubrinal Fig. 9 from Julien et al., 2016
spinal cord microtubule cytoskeleton organization disrupted, ameliorated WT + MO3-spast chemical treatment: Guanabenz Fig. 9 from Julien et al., 2016
reactive oxygen species metabolic process process quality, abnormal WT + MO3-spast standard conditions Fig. 9 from Julien et al., 2016
reactive oxygen species metabolic process process quality, ameliorated WT + MO3-spast chemical treatment: Guanabenz Fig. 9 from Julien et al., 2016
head hydrocephalic, abnormal WT + MO3-spast standard conditions Fig. 9 from Julien et al., 2016
motor neuron axon microtubule bundle decreased diameter, ameliorated WT + MO3-spast chemical treatment: phenazine Fig. 9 from Julien et al., 2016
spinal cord microtubule cytoskeleton organization disrupted, abnormal WT + MO3-spast standard conditions Fig. 9 from Julien et al., 2016
reactive oxygen species metabolic process process quality, ameliorated WT + MO3-spast chemical treatment: phenazine Fig. 9 from Julien et al., 2016
spinal cord microtubule cytoskeleton disorganized, ameliorated WT + MO3-spast chemical treatment: Guanabenz Fig. 9 from Julien et al., 2016
extension morphology, ameliorated WT + MO3-spast chemical treatment: Guanabenz Fig. 9 from Julien et al., 2016
motor neuron axon microtubule bundle decreased diameter, ameliorated WT + MO3-spast chemical treatment: Guanabenz Fig. 9 from Julien et al., 2016
motor neuron axon microtubule bundle decreased diameter, ameliorated WT + MO3-spast chemical treatment: salubrinal Fig. 9 from Julien et al., 2016
spinal cord microtubule cytoskeleton disorganized, ameliorated WT + MO3-spast chemical treatment: methylene blue Fig. 9 from Julien et al., 2016
whole organism arched, ameliorated WT + MO3-spast chemical treatment: methylene blue Fig. 9 from Julien et al., 2016
whole organism arched, ameliorated WT + MO3-spast chemical treatment: salubrinal Fig. 9 from Julien et al., 2016
extension morphology, ameliorated WT + MO3-spast chemical treatment: phenazine Fig. 9 from Julien et al., 2016
thigmotaxis process quality, abnormal WT + MO3-spast control Fig. 2 with image from Jardin et al., 2018
whole organism arched, ameliorated WT + MO3-spast chemical treatment: Guanabenz Fig. 9 from Julien et al., 2016
extension morphology, abnormal WT + MO3-spast standard conditions Fig. 9 from Julien et al., 2016
motor neuron axon microtubule bundle decreased diameter, ameliorated WT + MO3-spast chemical treatment: methylene blue Fig. 9 from Julien et al., 2016
spinal cord microtubule cytoskeleton disorganized, ameliorated WT + MO3-spast chemical treatment: salubrinal Fig. 9 from Julien et al., 2016
spinal cord microtubule cytoskeleton disorganized, abnormal WT + MO3-spast standard conditions Fig. 9 from Julien et al., 2016
head hydrocephalic, ameliorated WT + MO3-spast chemical treatment: salubrinal Fig. 9 from Julien et al., 2016
spinal cord microtubule cytoskeleton disorganized, ameliorated WT + MO3-spast chemical treatment: phenazine Fig. 9 from Julien et al., 2016
spinal cord microtubule cytoskeleton organization disrupted, ameliorated WT + MO3-spast chemical treatment: salubrinal Fig. 9 from Julien et al., 2016
reactive oxygen species metabolic process process quality, ameliorated WT + MO3-spast chemical treatment: methylene blue Fig. 9 from Julien et al., 2016
secondary motor neuron axon guidance process quality, abnormal ml2Tg + MO3-spast control Fig. 3 with image from Jardin et al., 2018
secondary motor neuron axon guidance process quality, abnormal w30Tg + MO3-spast control Fig. 6 with image from Jardin et al., 2018
secondary motor neuron axon guidance process quality, ameliorated w30Tg + MO3-spast heat shock Fig. 6 with image from Jardin et al., 2018
secondary motor neuron axon guidance process quality, exacerbated ml2Tg + MO1-atl1 + MO3-spast control Fig. 6 with image from Jardin et al., 2018
Citations