Community Action Needed: Please respond to the NIH RFI
Morpholino

MO3-hif1ab

ID
ZDB-MRPHLNO-130813-1
Name
MO3-hif1ab
Previous Names
  • ATGMOhif-1a (1)
Target
Sequence
5' - GTGACAACTCCAGTATCCATTCCTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-hif1ab
Phenotype
Phenotype resulting from MO3-hif1ab
Phenotype of all Fish created by or utilizing MO3-hif1ab
Phenotype Fish Conditions Figures
whole organism epoa expression decreased amount, abnormal WT + MO3-hif1ab standard conditions Fig. 4 with image from de Bruin et al., 2016
whole organism egln3 expression amount, ameliorated WT + MO3-hif1ab hypoxia Fig. S5 from de Bruin et al., 2016
neural crest cell migration decreased process quality, abnormal WT + MO3-hif1ab standard conditions Fig. 1 from Barriga et al., 2013
trunk motor neuron nrp1a expression increased amount, abnormal WT + MO3-hif1ab standard conditions Fig. 4 with image from de Bruin et al., 2016
head nrp1a expression increased amount, abnormal WT + MO3-hif1ab standard conditions Fig. 4 with image from de Bruin et al., 2016
whole organism nrp1b expression amount, ameliorated WT + MO3-hif1ab hypoxia Fig. S5 from de Bruin et al., 2016
whole organism nrp1a expression amount, ameliorated WT + MO3-hif1ab hypoxia Fig. S5 from de Bruin et al., 2016
splanchnocranium malformed, abnormal WT + MO3-hif1ab standard conditions Fig. 1 from Barriga et al., 2013
intestine goblet cell agr2 expression decreased amount, abnormal WT + MO3-hif1ab standard conditions Fig. 3 from Lai et al., 2016
goblet cell cell maturation disrupted, abnormal WT + MO3-hif1ab control Fig. 3 from Lai et al., 2016
motor neuron axon truncated, abnormal js12Tg + MO3-hif1ab standard conditions Fig. 6 from de Bruin et al., 2016
optic cup GFP expression increased amount, abnormal js12Tg + MO3-hif1ab standard conditions Fig. 5 with image from de Bruin et al., 2016
motor neuron axon guidance decreased process quality, abnormal js12Tg + MO3-hif1ab standard conditions Fig. 6 from de Bruin et al., 2016
retina GFP expression increased amount, abnormal js12Tg + MO3-hif1ab standard conditions Fig. 5 with image from de Bruin et al., 2016
intestine goblet cell agr2 expression decreased amount, abnormal WT + MO1-foxa2 + MO3-hif1ab standard conditions Fig. 6 from Lai et al., 2016
goblet cell cell maturation disrupted, abnormal WT + MO1-foxa2 + MO3-hif1ab standard conditions Fig. 6 from Lai et al., 2016
motor neuron axon truncated, ameliorated nrp1ahu10012/hu10012 ; js12Tg + MO3-hif1ab standard conditions Fig. 6 from de Bruin et al., 2016
motor neuron axon guidance decreased process quality, ameliorated nrp1ahu10012/hu10012 ; js12Tg + MO3-hif1ab standard conditions Fig. 6 from de Bruin et al., 2016
Citations