Morpholino

MO3-hif1ab

ID
ZDB-MRPHLNO-130813-1
Name
MO3-hif1ab
Previous Names
  • ATGMOhif-1a (1)
Target
Sequence
5' - GTGACAACTCCAGTATCCATTCCTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-hif1ab
Expressed Gene Anatomy Figures
agr2 Fig. 3 from Lai et al., 2016
crestin Fig. 1 from Barriga et al., 2013
dlx3b Fig. S2 from Barriga et al., 2013
epoa Fig. 4 with image from de Bruin et al., 2016
foxd3 Fig. S2 from Barriga et al., 2013
gsc Fig. S2 from Barriga et al., 2013
muc2.1 Fig. S10 from Lai et al., 2016
myod1 Fig. S2 from Barriga et al., 2013
nrp1a Fig. 4 with image from de Bruin et al., 2016
tbxta Fig. S2 from Barriga et al., 2013
tfap2a Fig. S2 from Barriga et al., 2013
Phenotype
Phenotype resulting from MO3-hif1ab
Phenotype Fish Figures
goblet cell cell maturation disrupted, abnormal WT + MO3-hif1ab Fig. 3 from Lai et al., 2016
head nrp1a expression increased amount, abnormal WT + MO3-hif1ab Fig. 4 with image from de Bruin et al., 2016
intestine goblet cell agr2 expression decreased amount, abnormal WT + MO3-hif1ab Fig. 3 from Lai et al., 2016
motor neuron axon truncated, abnormal js12Tg + MO3-hif1ab Fig. 6 from de Bruin et al., 2016
motor neuron axon guidance decreased process quality, abnormal js12Tg + MO3-hif1ab Fig. 6 from de Bruin et al., 2016
neural crest cell migration decreased process quality, abnormal WT + MO3-hif1ab Fig. 1 from Barriga et al., 2013
optic cup GFP expression increased amount, abnormal js12Tg + MO3-hif1ab Fig. 5 with image from de Bruin et al., 2016
retina GFP expression increased amount, abnormal js12Tg + MO3-hif1ab Fig. 5 with image from de Bruin et al., 2016
splanchnocranium malformed, abnormal WT + MO3-hif1ab Fig. 1 from Barriga et al., 2013
trunk motor neuron nrp1a expression increased amount, abnormal WT + MO3-hif1ab Fig. 4 with image from de Bruin et al., 2016
whole organism epoa expression decreased amount, abnormal WT + MO3-hif1ab Fig. 4 with image from de Bruin et al., 2016
Phenotype of all Fish created by or utilizing MO3-hif1ab
Phenotype Fish Conditions Figures
whole organism epoa expression decreased amount, abnormal WT + MO3-hif1ab standard conditions Fig. 4 with image from de Bruin et al., 2016
whole organism egln3 expression amount, ameliorated WT + MO3-hif1ab hypoxia Fig. S5 from de Bruin et al., 2016
neural crest cell migration decreased process quality, abnormal WT + MO3-hif1ab standard conditions Fig. 1 from Barriga et al., 2013
trunk motor neuron nrp1a expression increased amount, abnormal WT + MO3-hif1ab standard conditions Fig. 4 with image from de Bruin et al., 2016
head nrp1a expression increased amount, abnormal WT + MO3-hif1ab standard conditions Fig. 4 with image from de Bruin et al., 2016
whole organism nrp1b expression amount, ameliorated WT + MO3-hif1ab hypoxia Fig. S5 from de Bruin et al., 2016
whole organism nrp1a expression amount, ameliorated WT + MO3-hif1ab hypoxia Fig. S5 from de Bruin et al., 2016
splanchnocranium malformed, abnormal WT + MO3-hif1ab standard conditions Fig. 1 from Barriga et al., 2013
intestine goblet cell agr2 expression decreased amount, abnormal WT + MO3-hif1ab standard conditions Fig. 3 from Lai et al., 2016
goblet cell cell maturation disrupted, abnormal WT + MO3-hif1ab control Fig. 3 from Lai et al., 2016
motor neuron axon truncated, abnormal js12Tg + MO3-hif1ab standard conditions Fig. 6 from de Bruin et al., 2016
optic cup GFP expression increased amount, abnormal js12Tg + MO3-hif1ab standard conditions Fig. 5 with image from de Bruin et al., 2016
motor neuron axon guidance decreased process quality, abnormal js12Tg + MO3-hif1ab standard conditions Fig. 6 from de Bruin et al., 2016
retina GFP expression increased amount, abnormal js12Tg + MO3-hif1ab standard conditions Fig. 5 with image from de Bruin et al., 2016
intestine goblet cell agr2 expression decreased amount, abnormal WT + MO1-foxa2 + MO3-hif1ab standard conditions Fig. 6 from Lai et al., 2016
goblet cell cell maturation disrupted, abnormal WT + MO1-foxa2 + MO3-hif1ab standard conditions Fig. 6 from Lai et al., 2016
motor neuron axon truncated, ameliorated nrp1ahu10012/hu10012; js12Tg + MO3-hif1ab standard conditions Fig. 6 from de Bruin et al., 2016
motor neuron axon guidance decreased process quality, ameliorated nrp1ahu10012/hu10012; js12Tg + MO3-hif1ab standard conditions Fig. 6 from de Bruin et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.