Morpholino

MO2-dnaaf4

ID
ZDB-MRPHLNO-130717-2
Name
MO2-dnaaf4
Previous Names
  • MO2-dyx1c1
  • SPMO (1)
Target
Sequence
5' - TGACAGTCAACATGTCTTACCGATG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-dnaaf4
No data available
Phenotype
Phenotype resulting from MO2-dnaaf4
Phenotype of all Fish created by or utilizing MO2-dnaaf4
Phenotype Fish Conditions Figures
pronephric duct dilated, abnormal AB + MO1-dnaaf4 + MO2-dnaaf4 standard conditions Fig. 6 with image from Chandrasekar et al., 2013
pronephros lacks parts or has fewer parts of type epithelial cell microvillus, abnormal AB + MO1-dnaaf4 + MO2-dnaaf4 standard conditions Fig. 6 with image from Chandrasekar et al., 2013
determination of digestive tract left/right asymmetry disrupted, abnormal AB + MO1-dnaaf4 + MO2-dnaaf4 standard conditions Fig. 4 with image from Chandrasekar et al., 2013
determination of liver left/right asymmetry disrupted, abnormal AB + MO1-dnaaf4 + MO2-dnaaf4 standard conditions Fig. 4 with image from Chandrasekar et al., 2013
pronephros outer dynein arm absent, abnormal AB + MO1-dnaaf4 + MO2-dnaaf4 standard conditions Fig. 6 with image from Chandrasekar et al., 2013
pronephros distended, abnormal AB + MO1-dnaaf4 + MO2-dnaaf4 standard conditions Fig. 3 with image from Chandrasekar et al., 2013
determination of left/right symmetry disrupted, abnormal AB + MO1-dnaaf4 + MO2-dnaaf4 standard conditions Fig. 4 with image from Chandrasekar et al., 2013
swimming behavior process quality, abnormal AB + MO1-dnaaf4 + MO2-dnaaf4 standard conditions text only from Chandrasekar et al., 2013
heart looping disrupted, abnormal AB + MO1-dnaaf4 + MO2-dnaaf4 standard conditions Fig. 4 with image from Chandrasekar et al., 2013
pronephros inner dynein arm absent, abnormal AB + MO1-dnaaf4 + MO2-dnaaf4 standard conditions Fig. 6 with image from Chandrasekar et al., 2013
heart inverted, abnormal AB + MO1-dnaaf4 + MO2-dnaaf4 standard conditions Fig. 4 with image from Chandrasekar et al., 2013
olfactory placode outer dynein arm absent, abnormal AB + MO1-dnaaf4 + MO2-dnaaf4 standard conditions Fig. S3 with image from Chandrasekar et al., 2013
pronephric glomerulus decreased thickness, abnormal AB + MO1-dnaaf4 + MO2-dnaaf4 standard conditions Fig. 3 with image from Chandrasekar et al., 2013
parapineal organ right side of whole organism, abnormal AB + MO1-dnaaf4 + MO2-dnaaf4 standard conditions Fig. 4 with image from Chandrasekar et al., 2013
olfactory placode inner dynein arm absent, abnormal AB + MO1-dnaaf4 + MO2-dnaaf4 standard conditions Fig. S3 with image from Chandrasekar et al., 2013
pronephros brush border absent, abnormal AB + MO1-dnaaf4 + MO2-dnaaf4 standard conditions Fig. 6 with image from Chandrasekar et al., 2013
pronephros axoneme structure, abnormal AB + MO1-dnaaf4 + MO2-dnaaf4 standard conditions Fig. 6 with image from Chandrasekar et al., 2013
determination of pancreatic left/right asymmetry disrupted, abnormal AB + MO1-dnaaf4 + MO2-dnaaf4 standard conditions Fig. 4 with image from Chandrasekar et al., 2013
brain hydrocephalic, abnormal AB + MO2-dnaaf4 standard conditions Fig. S1 with image from Chandrasekar et al., 2013
whole organism anterior-posterior axis curved ventral, abnormal AB + MO2-dnaaf4 standard conditions Fig. S1 with image from Chandrasekar et al., 2013
pronephros cystic, abnormal AB + MO2-dnaaf4 standard conditions Fig. S1 with image from Chandrasekar et al., 2013
pronephros cilium decreased length, abnormal WT + MO1-dnaaf4 + MO2-dnaaf4 standard conditions Fig. 5 with image from Chandrasekar et al., 2013
Kupffer's vesicle cilium decreased amount, abnormal WT + MO1-dnaaf4 + MO2-dnaaf4 standard conditions Fig. 5 with image from Chandrasekar et al., 2013
Kupffer's vesicle cilium decreased length, abnormal WT + MO1-dnaaf4 + MO2-dnaaf4 standard conditions Fig. 5 with image from Chandrasekar et al., 2013
peripheral olfactory organ cilium decreased length, abnormal WT + MO1-dnaaf4 + MO2-dnaaf4 standard conditions Fig. 5 with image from Chandrasekar et al., 2013
spinal cord cilium decreased length, abnormal WT + MO1-dnaaf4 + MO2-dnaaf4 standard conditions Fig. 5 with image from Chandrasekar et al., 2013
post-vent region curved, abnormal AB + MO1-dcdc2b + MO1-dnaaf4 + MO2-dnaaf4 control Fig. 3 with image from Bieder et al., 2023
Citations