Morpholino

MO1-dnaaf4

ID

ZDB-MRPHLNO-130717-1

Name

MO1-dnaaf4

Previous Names

ATGMO (1)
MO1-dyx1c1

Target

dnaaf4 (1)

Sequence

5' - GTGATCTCTCACTATCAGCGGCATC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-dnaaf4

Expressed Gene	Anatomy	Figures
dcdc2b	whole organism	Fig. 4 from Bieder et al., 2023

Phenotype

Phenotype resulting from MO1-dnaaf4

Phenotype	Fish	Figures
brain hydrocephalic, abnormal	AB + MO1-dnaaf4	Fig. 3 , Fig. S1 from Chandrasekar et al., 2013
pronephros cystic, abnormal	AB + MO1-dnaaf4	Fig. 3 , Fig. S1 from Chandrasekar et al., 2013
whole organism anterior-posterior axis curved ventral, abnormal	AB + MO1-dnaaf4	Fig. 3 , Fig. S1 from Chandrasekar et al., 2013

Phenotype of all Fish created by or utilizing MO1-dnaaf4

Phenotype	Fish	Conditions	Figures
pronephros cystic, abnormal	AB + MO1-dnaaf4	standard conditions	Fig. 3 , Fig. S1 from Chandrasekar et al., 2013
brain hydrocephalic, abnormal	AB + MO1-dnaaf4	standard conditions	Fig. 3 , Fig. S1 from Chandrasekar et al., 2013
whole organism anterior-posterior axis curved ventral, abnormal	AB + MO1-dnaaf4	standard conditions	Fig. 3 , Fig. S1 from Chandrasekar et al., 2013
pronephric duct dilated, abnormal	AB + MO1-dnaaf4 + MO2-dnaaf4	standard conditions	Fig. 6 from Chandrasekar et al., 2013
pronephros lacks parts or has fewer parts of type epithelial cell microvillus, abnormal	AB + MO1-dnaaf4 + MO2-dnaaf4	standard conditions	Fig. 6 from Chandrasekar et al., 2013
determination of digestive tract left/right asymmetry disrupted, abnormal	AB + MO1-dnaaf4 + MO2-dnaaf4	standard conditions	Fig. 4 from Chandrasekar et al., 2013
determination of liver left/right asymmetry disrupted, abnormal	AB + MO1-dnaaf4 + MO2-dnaaf4	standard conditions	Fig. 4 from Chandrasekar et al., 2013
pronephros outer dynein arm absent, abnormal	AB + MO1-dnaaf4 + MO2-dnaaf4	standard conditions	Fig. 6 from Chandrasekar et al., 2013
pronephros distended, abnormal	AB + MO1-dnaaf4 + MO2-dnaaf4	standard conditions	Fig. 3 from Chandrasekar et al., 2013
determination of left/right symmetry disrupted, abnormal	AB + MO1-dnaaf4 + MO2-dnaaf4	standard conditions	Fig. 4 from Chandrasekar et al., 2013
swimming behavior process quality, abnormal	AB + MO1-dnaaf4 + MO2-dnaaf4	standard conditions	text only from Chandrasekar et al., 2013
heart looping disrupted, abnormal	AB + MO1-dnaaf4 + MO2-dnaaf4	standard conditions	Fig. 4 from Chandrasekar et al., 2013
pronephros inner dynein arm absent, abnormal	AB + MO1-dnaaf4 + MO2-dnaaf4	standard conditions	Fig. 6 from Chandrasekar et al., 2013
heart inverted, abnormal	AB + MO1-dnaaf4 + MO2-dnaaf4	standard conditions	Fig. 4 from Chandrasekar et al., 2013
olfactory placode outer dynein arm absent, abnormal	AB + MO1-dnaaf4 + MO2-dnaaf4	standard conditions	Fig. S3 from Chandrasekar et al., 2013
pronephric glomerulus decreased thickness, abnormal	AB + MO1-dnaaf4 + MO2-dnaaf4	standard conditions	Fig. 3 from Chandrasekar et al., 2013
parapineal organ right side of whole organism, abnormal	AB + MO1-dnaaf4 + MO2-dnaaf4	standard conditions	Fig. 4 from Chandrasekar et al., 2013
olfactory placode inner dynein arm absent, abnormal	AB + MO1-dnaaf4 + MO2-dnaaf4	standard conditions	Fig. S3 from Chandrasekar et al., 2013
pronephros brush border absent, abnormal	AB + MO1-dnaaf4 + MO2-dnaaf4	standard conditions	Fig. 6 from Chandrasekar et al., 2013
pronephros axoneme structure, abnormal	AB + MO1-dnaaf4 + MO2-dnaaf4	standard conditions	Fig. 6 from Chandrasekar et al., 2013
determination of pancreatic left/right asymmetry disrupted, abnormal	AB + MO1-dnaaf4 + MO2-dnaaf4	standard conditions	Fig. 4 from Chandrasekar et al., 2013
pronephros cilium decreased length, abnormal	WT + MO1-dnaaf4 + MO2-dnaaf4	standard conditions	Fig. 5 from Chandrasekar et al., 2013
Kupffer's vesicle cilium decreased amount, abnormal	WT + MO1-dnaaf4 + MO2-dnaaf4	standard conditions	Fig. 5 from Chandrasekar et al., 2013
Kupffer's vesicle cilium decreased length, abnormal	WT + MO1-dnaaf4 + MO2-dnaaf4	standard conditions	Fig. 5 from Chandrasekar et al., 2013
peripheral olfactory organ cilium decreased length, abnormal	WT + MO1-dnaaf4 + MO2-dnaaf4	standard conditions	Fig. 5 from Chandrasekar et al., 2013
spinal cord cilium decreased length, abnormal	WT + MO1-dnaaf4 + MO2-dnaaf4	standard conditions	Fig. 5 from Chandrasekar et al., 2013
post-vent region curved, abnormal	AB + MO1-dcdc2b + MO1-dnaaf4 + MO2-dnaaf4	control	Fig. 3 from Bieder et al., 2023

Citations