Morpholino

MO1-inpp5e

ID
ZDB-MRPHLNO-130206-1
Name
MO1-inpp5e
Previous Names
None
Target
Sequence
5' - GCTCACTCATCCTATTGGCGGGCTT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-inpp5e
Expressed Gene Anatomy Figures
cdh17 Fig. 3 from Xu et al., 2017
ezrb Fig. 3 from Xu et al., 2017
Phenotype
Phenotype resulting from MO1-inpp5e
Phenotype Fish Figures
eye decreased size, abnormal AB/TU + MO1-inpp5e + MO4-tp53 Fig. 2 with image from Luo et al., 2012
Kupffer's vesicle cilium decreased amount, abnormal AB/TU + MO1-inpp5e Fig. 4 with image from Luo et al., 2012
Kupffer's vesicle cilium decreased length, abnormal AB/TU + MO1-inpp5e Fig. 4 with image from Luo et al., 2012
melanosome transport increased duration, abnormal AB/TU + MO1-inpp5e Fig. 6 with image from Luo et al., 2012
multi-ciliated epithelial cell malformed, abnormal TU + MO1-inpp5e Fig. S7 from Xu et al., 2018
pericardium edematous, abnormal AB/TU + MO1-inpp5e + MO4-tp53 Fig. 2 with image from Luo et al., 2012
post-vent region kinked, abnormal AB/TU + MO1-inpp5e + MO4-tp53 Fig. 2 with image from Luo et al., 2012
pronephric duct has fewer parts of type pronephric duct motile cilium, abnormal TU + MO1-inpp5e Fig. 4 from Xu et al., 2017
pronephric duct 1-phosphatidyl-1D-myo-inositol 3,4,5-trisphosphate mislocalised, abnormal TU + MO1-inpp5e Fig. 1 from Xu et al., 2017
pronephric duct 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate mislocalised, abnormal TU + MO1-inpp5e Fig. 1 from Xu et al., 2017
pronephric duct actin filament bundle distribution decreased process quality, abnormal TU + MO1-inpp5e Fig. 1 from Xu et al., 2017
pronephric duct apical plasma membrane ezrb expression absent, abnormal TU + MO1-inpp5e Fig. 3 from Xu et al., 2017
pronephric duct apical plasma membrane ab1-atp1a1 labeling mislocalised, abnormal TU + MO1-inpp5e Fig. 1 from Xu et al., 2017
pronephric duct ciliary basal body mislocalised, abnormal TU + MO1-inpp5e Fig. 1 from Xu et al., 2017
pronephric duct ciliary basal body-plasma membrane docking decreased process quality, abnormal TU + MO1-inpp5e Fig. 1 from Xu et al., 2017
pronephric duct cilium decreased length, abnormal AB/TU + MO1-inpp5e Fig. 5 with image from Luo et al., 2012
pronephric duct cilium assembly decreased occurrence, abnormal TU + MO1-inpp5e Fig. 1,  Fig. 4 from Xu et al., 2017
pronephric duct establishment of epithelial cell apical/basal polarity decreased process quality, abnormal TU + MO1-inpp5e Fig. 1 from Xu et al., 2017
pronephric duct filamentous actin mislocalised, abnormal TU + MO1-inpp5e Fig. 1 from Xu et al., 2017
pronephric glomerulus cystic, abnormal TU + MO1-inpp5e Fig. 3,  Fig. 4 from Xu et al., 2017
pronephric tubule ciliary basal body mislocalised, abnormal TU + MO1-inpp5e Fig. S5 from Xu et al., 2018
pronephric tubule cilium decreased amount, abnormal TU + MO1-inpp5e Fig. S7 from Xu et al., 2018
pronephros cystic, abnormal AB/TU + MO1-inpp5e + MO4-tp53 Fig. 2 with image from Luo et al., 2012
pronephros renal filtration decreased rate, abnormal TU + MO1-inpp5e Fig. 4 from Xu et al., 2017
pronephros morphogenesis decreased process quality, abnormal TU + MO1-inpp5e Fig. 1,  Fig. 4 from Xu et al., 2017
retina disorganized, abnormal AB/TU + MO1-inpp5e + MO4-tp53 Fig. 2 with image from Luo et al., 2012
retina development in camera-type eye disrupted, abnormal AB/TU + MO1-inpp5e + MO4-tp53 Fig. 2 with image from Luo et al., 2012
whole organism decreased pigmentation, abnormal AB/TU + MO1-inpp5e + MO4-tp53 Fig. 2 with image from Luo et al., 2012
whole organism anatomical axis asymmetrical, abnormal AB/TU + MO1-inpp5e + MO4-tp53 Fig. 2 with image from Luo et al., 2012
Phenotype of all Fish created by or utilizing MO1-inpp5e
Phenotype Fish Conditions Figures
Kupffer's vesicle cilium decreased amount, abnormal AB/TU + MO1-inpp5e standard conditions Fig. 4 with image from Luo et al., 2012
melanosome transport increased duration, abnormal AB/TU + MO1-inpp5e standard conditions Fig. 6 with image from Luo et al., 2012
Kupffer's vesicle cilium decreased length, abnormal AB/TU + MO1-inpp5e standard conditions Fig. 4 with image from Luo et al., 2012
pronephric duct cilium decreased length, abnormal AB/TU + MO1-inpp5e standard conditions Fig. 5 with image from Luo et al., 2012
post-vent region kinked, abnormal AB/TU + MO1-inpp5e + MO4-tp53 standard conditions Fig. 2 with image from Luo et al., 2012
pronephros cystic, abnormal AB/TU + MO1-inpp5e + MO4-tp53 standard conditions Fig. 2 with image from Luo et al., 2012
whole organism anatomical axis asymmetrical, abnormal AB/TU + MO1-inpp5e + MO4-tp53 standard conditions Fig. 2 with image from Luo et al., 2012
retina development in camera-type eye disrupted, abnormal AB/TU + MO1-inpp5e + MO4-tp53 standard conditions Fig. 2 with image from Luo et al., 2012
pericardium edematous, abnormal AB/TU + MO1-inpp5e + MO4-tp53 standard conditions Fig. 2 with image from Luo et al., 2012
eye decreased size, abnormal AB/TU + MO1-inpp5e + MO4-tp53 standard conditions Fig. 2 with image from Luo et al., 2012
whole organism decreased pigmentation, abnormal AB/TU + MO1-inpp5e + MO4-tp53 standard conditions Fig. 2 with image from Luo et al., 2012
retina disorganized, abnormal AB/TU + MO1-inpp5e + MO4-tp53 standard conditions Fig. 2 with image from Luo et al., 2012
pronephric tubule cilium decreased amount, abnormal TU + MO1-inpp5e standard conditions Fig. S7 from Xu et al., 2018
pronephric duct 1-phosphatidyl-1D-myo-inositol 3,4,5-trisphosphate mislocalised, abnormal TU + MO1-inpp5e standard conditions Fig. 1 from Xu et al., 2017
pronephric duct cilium assembly occurrence, ameliorated TU + MO1-inpp5e chemical treatment by environment: LY294002 Fig. 4 from Xu et al., 2017
pronephric duct has number of pronephric duct motile cilium, ameliorated TU + MO1-inpp5e chemical treatment by environment: LY294002 Fig. 4 from Xu et al., 2017
pronephric glomerulus morphology, ameliorated TU + MO1-inpp5e chemical treatment by environment: LY294002 Fig. 4 from Xu et al., 2017
pronephros morphogenesis process quality, ameliorated TU + MO1-inpp5e chemical treatment by environment: LY294002 Fig. 4 from Xu et al., 2017
pronephric duct cilium assembly decreased occurrence, abnormal TU + MO1-inpp5e control Fig. 1,  Fig. 4 from Xu et al., 2017
pronephros morphogenesis decreased process quality, abnormal TU + MO1-inpp5e standard conditions Fig. 1,  Fig. 4 from Xu et al., 2017
pronephros renal filtration rate, ameliorated TU + MO1-inpp5e chemical treatment by environment: LY294002 Fig. 4 from Xu et al., 2017
pronephric duct filamentous actin mislocalised, abnormal TU + MO1-inpp5e standard conditions Fig. 1 from Xu et al., 2017
pronephric duct 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate mislocalised, abnormal TU + MO1-inpp5e standard conditions Fig. 1 from Xu et al., 2017
pronephric tubule ciliary basal body mislocalised, abnormal TU + MO1-inpp5e standard conditions Fig. S5 from Xu et al., 2018
multi-ciliated epithelial cell malformed, abnormal TU + MO1-inpp5e standard conditions Fig. S7 from Xu et al., 2018
pronephric duct establishment of epithelial cell apical/basal polarity decreased process quality, abnormal TU + MO1-inpp5e standard conditions Fig. 1 from Xu et al., 2017
pronephric glomerulus cystic, abnormal TU + MO1-inpp5e standard conditions Fig. 3,  Fig. 4 from Xu et al., 2017
pronephric duct ciliary basal body-plasma membrane docking decreased process quality, abnormal TU + MO1-inpp5e standard conditions Fig. 1 from Xu et al., 2017
pronephros renal filtration decreased rate, abnormal TU + MO1-inpp5e control Fig. 4 from Xu et al., 2017
pronephric duct ciliary basal body mislocalised, abnormal TU + MO1-inpp5e standard conditions Fig. 1 from Xu et al., 2017
pronephric duct has fewer parts of type pronephric duct motile cilium, abnormal TU + MO1-inpp5e control Fig. 4 from Xu et al., 2017
pronephric duct apical plasma membrane ab1-atp1a1 labeling mislocalised, abnormal TU + MO1-inpp5e standard conditions Fig. 1 from Xu et al., 2017
pronephric duct apical plasma membrane ezrb expression absent, abnormal TU + MO1-inpp5e standard conditions Fig. 3 from Xu et al., 2017
pronephric duct actin filament bundle distribution decreased process quality, abnormal TU + MO1-inpp5e standard conditions Fig. 1 from Xu et al., 2017
kidney cystic, exacerbated TU + MO1-inpp5e + MO1-pip5k1aa standard conditions Fig. S6 from Xu et al., 2018
kidney cystic, exacerbated TU + MO1-inpp5e + MO1-pip5k1ca standard conditions Fig. S6 from Xu et al., 2018
pronephric glomerulus cystic, exacerbated TU + MO1-inpp5e + MO2-ezrb standard conditions Fig. 3 from Xu et al., 2017
kidney cystic, exacerbated TU + MO1-inpp5e + MO2-pip5k1ab standard conditions Fig. S6 from Xu et al., 2018
pronephric duct establishment of epithelial cell apical/basal polarity process quality, ameliorated tju9Tg + MO1-inpp5e chemical treatment by environment: LY294002 Fig. 4 from Xu et al., 2017
pronephric duct 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate mislocalised, abnormal tju9Tg + MO1-inpp5e control Fig. 4 from Xu et al., 2017
pronephric duct establishment of epithelial cell apical/basal polarity decreased process quality, abnormal tju9Tg + MO1-inpp5e control Fig. 4 from Xu et al., 2017
pronephric duct apical plasma membrane EGFP expression decreased amount, abnormal tju9Tg + MO1-inpp5e control Fig. 4 from Xu et al., 2017
pronephric duct apical plasma membrane EGFP expression amount, ameliorated tju9Tg + MO1-inpp5e chemical treatment by environment: LY294002 Fig. 4 from Xu et al., 2017
pronephric duct 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate position, ameliorated tju9Tg + MO1-inpp5e chemical treatment by environment: LY294002 Fig. 4 from Xu et al., 2017
pronephric duct 1-phosphatidyl-1D-myo-inositol 3,4,5-trisphosphate mislocalised, abnormal tju10Tg + MO1-inpp5e control Fig. 4 from Xu et al., 2017
pronephric duct 1-phosphatidyl-1D-myo-inositol 3,4,5-trisphosphate position, ameliorated tju10Tg + MO1-inpp5e chemical treatment by environment: LY294002 Fig. 4 from Xu et al., 2017
pronephric duct establishment of epithelial cell apical/basal polarity process quality, ameliorated tju10Tg + MO1-inpp5e chemical treatment by environment: LY294002 Fig. 4 from Xu et al., 2017
pronephric duct apical plasma membrane EGFP expression position, ameliorated tju10Tg + MO1-inpp5e chemical treatment by environment: LY294002 Fig. 4 from Xu et al., 2017
pronephric duct apical plasma membrane EGFP expression mislocalised, abnormal tju10Tg + MO1-inpp5e control Fig. 4 from Xu et al., 2017
pronephric duct establishment of epithelial cell apical/basal polarity decreased process quality, abnormal tju10Tg + MO1-inpp5e control Fig. 4 from Xu et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.