Morpholino

MO1-itga6a

ID
ZDB-MRPHLNO-121219-4
Name
MO1-itga6a
Previous Names
None
Target
Sequence
5' - AGCTCCATTGCCTGAAATGAATG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-itga6a
No data available
Phenotype
Phenotype resulting from MO1-itga6a
No data available
Phenotype of all Fish created by or utilizing MO1-itga6a
Phenotype Fish Conditions Figures
vertical myoseptum malformed, abnormal WT + MO1-itga6a + MO2-itga6a standard conditions Fig. 7 with image from Goody et al., 2012
myotome muscle cell increased length, abnormal WT + MO1-itga6a + MO2-itga6a standard conditions Fig. 5 with imageFig. 7 with image from Goody et al., 2012
myotome muscle tendon junction U-shaped, abnormal WT + MO1-itga6a + MO2-itga6a standard conditions Fig. 5 with image from Goody et al., 2012
myotome decreased width, abnormal WT + MO1-itga6a + MO2-itga6a standard conditions Fig. 4 with image from Goody et al., 2012
whole organism decreased length, abnormal WT + MO1-itga6a + MO2-itga6a standard conditions Fig. 4 with image from Goody et al., 2012
vertical myoseptum U-shaped, abnormal WT + MO1-itga6a + MO2-itga6a standard conditions Fig. 5 with image from Goody et al., 2012
myotome muscle tendon junction malformed, abnormal WT + MO1-itga6a + MO2-itga6a standard conditions Fig. 4 with imageFig. 5 with image from Goody et al., 2012
myotome muscle tendon junction U-shaped, abnormal WT + MO1-itga6a + MO2-itga6a + MO9-tp53 standard conditions Fig. 5 with image from Goody et al., 2012
vertical myoseptum U-shaped, abnormal WT + MO1-itga6a + MO2-itga6a + MO9-tp53 standard conditions Fig. 5 with image from Goody et al., 2012
myotome muscle cell increased length, abnormal WT + MO1-itga6a + MO2-itga6a + MO9-tp53 standard conditions Fig. 5 with image from Goody et al., 2012
myotome muscle tendon junction malformed, abnormal WT + MO1-itga6a + MO2-itga6a + MO9-tp53 standard conditions Fig. 5 with image from Goody et al., 2012
myotome muscle tendon junction malformed, abnormal lamc1wi390Tg/wi390Tg + MO1-itga6a + MO2-itga6a standard conditions Fig. 4 with image from Goody et al., 2012
trunk decreased length, abnormal lamc1wi390Tg/wi390Tg + MO1-itga6a + MO2-itga6a standard conditions Fig. 4 with image from Goody et al., 2012
post-vent region decreased length, abnormal lamc1wi390Tg/wi390Tg + MO1-itga6a + MO2-itga6a standard conditions Fig. 4 with image from Goody et al., 2012
vertical myoseptum U-shaped, abnormal WT + MO1-dag1 + MO1-itga6a + MO2-itga6a standard conditions Fig. 5 with image from Goody et al., 2012
vertical myoseptum U-shaped, abnormal WT + MO1-dag1 + MO1-itga6a + MO2-itga6a chemical treatment: NAD(+) Fig. 5 with image from Goody et al., 2012
myotome muscle tendon junction U-shaped, abnormal WT + MO1-dag1 + MO1-itga6a + MO2-itga6a standard conditions Fig. 5 with image from Goody et al., 2012
myotome muscle tendon junction U-shaped, abnormal WT + MO1-dag1 + MO1-itga6a + MO2-itga6a chemical treatment: NAD(+) Fig. 5 with image from Goody et al., 2012
myotome muscle cell degenerate, abnormal WT + MO1-dag1 + MO1-itga6a + MO2-itga6a standard conditions Fig. 5 with image from Goody et al., 2012
myotome muscle cell degenerate, abnormal WT + MO1-dag1 + MO1-itga6a + MO2-itga6a chemical treatment: NAD(+) Fig. 5 with image from Goody et al., 2012
vertical myoseptum malformed, abnormal mai1Tg + MO1-itga6a + MO2-itga6a standard conditions Fig. 7 with image from Goody et al., 2012
myotome muscle cell increased length, abnormal mai1Tg + MO1-itga6a + MO2-itga6a standard conditions Fig. 7 with image from Goody et al., 2012
Citations