Morpholino

MO1-hirip3

ID
ZDB-MRPHLNO-121207-8
Name
MO1-hirip3
Previous Names
None
Target
Sequence
5' - TTATCGCGTCCTTTTCTTTGGCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genome Build: GRCz11Chromosome: 3
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-hirip3
No data available
Phenotype
Phenotype resulting from MO1-hirip3
Phenotype of all Fish created by or utilizing MO1-hirip3
Phenotype Fish Conditions Figures
post-vent region shape, abnormal WT + MO1-hirip3 standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
brain morphology, abnormal WT + MO1-hirip3 standard conditions Fig. 2 with image from Blaker-Lee et al., 2012
pigment cell decreased amount, abnormal WT + MO1-hirip3 standard conditions Fig. S3 with image from Blaker-Lee et al., 2012
post-vent region decreased length, abnormal WT + MO1-hirip3 standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
whole organism pigmented, abnormal WT + MO1-hirip3 standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
whole organism movement quality, abnormal WT + MO1-hirip3 standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
somite U-shaped, abnormal WT + MO1-hirip3 standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
ventricular system decreased size, abnormal WT + MO1-hirip3 standard conditions Fig. 2 with image from Blaker-Lee et al., 2012
thigmotaxis decreased process quality, abnormal WT + MO1-hirip3 standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
skeletal muscle cell morphology, abnormal AB + MO1-asphd1 + MO1-hirip3 + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
ventricular system morphology, abnormal AB + MO1-asphd1 + MO1-hirip3 + MO4-tp53 standard conditions Fig. S1 with imageTable S2 from McCammon et al., 2017
skeletal muscle cell disorganized, abnormal AB + MO1-asphd1 + MO1-hirip3 + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
brain morphology, abnormal AB + MO1-asphd1 + MO1-hirip3 + MO4-tp53 standard conditions Fig. S1 with imageTable S2 from McCammon et al., 2017
ventricular system morphology, abnormal AB + MO1-hirip3 + MO1-kif22 + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
brain morphology, abnormal AB + MO1-hirip3 + MO1-kif22 + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
enteric neuron decreased amount, abnormal AB + MO1-hirip3 + MO1-kif22 + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
ventricular system morphology, abnormal AB + MO1-hirip3 + MO1-tlcd3ba + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
brain morphology, abnormal AB + MO1-hirip3 + MO1-tlcd3ba + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
central nervous system neuron differentiation process quality, abnormal nl1Tg + MO1-hirip3 + MO1-kif22 + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
central nervous system neuron differentiation process quality, abnormal nl1Tg + MO1-hirip3 + MO1-tlcd3ba + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
cranial nerve development process quality, abnormal rw0Tg + MO1-asphd1 + MO1-hirip3 + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
cranial nerve VII shape, abnormal rw0Tg + MO1-hirip3 + MO1-tlcd3ba + MO4-tp53 standard conditions Fig. S3 with image from McCammon et al., 2017
cranial nerve development process quality, abnormal rw0Tg + MO1-hirip3 + MO1-tlcd3ba + MO4-tp53 standard conditions Fig. S3 with imageTable S2 from McCammon et al., 2017
cranial nerve V decreased size, abnormal rw0Tg + MO1-hirip3 + MO1-tlcd3ba + MO4-tp53 standard conditions Fig. S3 with image from McCammon et al., 2017
Citations