Morpholino

MO5-mapk3

ID
ZDB-MRPHLNO-121207-14
Name
MO5-mapk3
Previous Names
None
Target
Sequence
5' - GTACGATATAGCTGAAACGCGGTTA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-mapk3
No data available
Phenotype
Phenotype resulting from MO5-mapk3
Phenotype Fish Figures
brain morphology, abnormal WT + MO5-mapk3 Fig. 2 with image from Blaker-Lee et al., 2012
central nervous system projection neuron axonogenesis disrupted, abnormal WT + MO5-mapk3 Fig. 3 with image from Blaker-Lee et al., 2012
eye morphology, abnormal WT + MO5-mapk3 Fig. 3 with image from Blaker-Lee et al., 2012
forebrain axon decreased size, abnormal WT + MO5-mapk3 Fig. 5 with image from Blaker-Lee et al., 2012
forebrain axon disorganized, abnormal WT + MO5-mapk3 Fig. 5 with image from Blaker-Lee et al., 2012
hindbrain axon decreased length, abnormal WT + MO5-mapk3 Fig. 5 with image from Blaker-Lee et al., 2012
hindbrain axon disorganized, abnormal WT + MO5-mapk3 Fig. 5 with image from Blaker-Lee et al., 2012
pigment cell decreased amount, abnormal WT + MO5-mapk3 Fig. S3 with image from Blaker-Lee et al., 2012
post-vent region decreased length, abnormal WT + MO5-mapk3 Fig. 3 with image from Blaker-Lee et al., 2012
post-vent region shape, abnormal WT + MO5-mapk3 Fig. 3 with image from Blaker-Lee et al., 2012
somite U-shaped, abnormal WT + MO5-mapk3 Fig. 3 with image from Blaker-Lee et al., 2012
thigmotaxis decreased process quality, abnormal WT + MO5-mapk3 Fig. 3 with image from Blaker-Lee et al., 2012
whole organism pigmented, abnormal WT + MO5-mapk3 Fig. 3 with image from Blaker-Lee et al., 2012
Phenotype of all Fish created by or utilizing MO5-mapk3
Phenotype Fish Conditions Figures
post-vent region decreased length, abnormal WT + MO5-mapk3 standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
eye morphology, abnormal WT + MO5-mapk3 standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
thigmotaxis decreased process quality, abnormal WT + MO5-mapk3 standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
forebrain axon disorganized, abnormal WT + MO5-mapk3 standard conditions Fig. 5 with image from Blaker-Lee et al., 2012
brain morphology, abnormal WT + MO5-mapk3 standard conditions Fig. 2 with image from Blaker-Lee et al., 2012
hindbrain axon decreased length, abnormal WT + MO5-mapk3 standard conditions Fig. 5 with image from Blaker-Lee et al., 2012
post-vent region shape, abnormal WT + MO5-mapk3 standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
hindbrain axon disorganized, abnormal WT + MO5-mapk3 standard conditions Fig. 5 with image from Blaker-Lee et al., 2012
pigment cell decreased amount, abnormal WT + MO5-mapk3 standard conditions Fig. S3 with image from Blaker-Lee et al., 2012
somite U-shaped, abnormal WT + MO5-mapk3 standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
forebrain axon decreased size, abnormal WT + MO5-mapk3 standard conditions Fig. 5 with image from Blaker-Lee et al., 2012
central nervous system projection neuron axonogenesis disrupted, abnormal WT + MO5-mapk3 standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
whole organism pigmented, abnormal WT + MO5-mapk3 standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.