Morpholino

MO1-msgn1

ID
ZDB-MRPHLNO-121205-1
Name
MO1-msgn1
Previous Names
None
Target
Sequence
5' - CACATCCACGTCGATTTGCGCCATG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-msgn1
No data available
Phenotype
Phenotype resulting from MO1-msgn1
Phenotype of all Fish created by or utilizing MO1-msgn1
Phenotype Fish Conditions Figures
mesodermal cell migration decreased occurrence, abnormal WT + MO1-msgn1 standard conditions Fig. 5 with image from Fior et al., 2012
segmental plate decreased cellular motility, abnormal WT + MO1-msgn1 standard conditions Fig. 6 with image from Fior et al., 2012
post-vent region has extra parts of type somite, abnormal WT + MO1-msgn1 standard conditions Fig. 7 with image from Fior et al., 2012
segmental plate poorly differentiated, abnormal WT + MO1-msgn1 standard conditions Fig. 2 with imageFig. 5 with image from Fior et al., 2012
paraxial mesodermal cell differentiation decreased process quality, abnormal WT + MO1-msgn1 standard conditions Fig. 2 with imageFig. 5 with image from Fior et al., 2012
somite decreased size, abnormal WT + MO1-msgn1 standard conditions Fig. 7 with image from Fior et al., 2012
tail bud increased size, abnormal WT + MO1-msgn1 standard conditions Fig. 1 with image from Yabe et al., 2012
tail bud cellular quality, abnormal WT + MO1-msgn1 standard conditions Fig. 1 with imageFig. 2 with imageFig. 6 with image from Fior et al., 2012
paraxial mesodermal cell differentiation process quality, abnormal WT + MO1-msgn1 standard conditions Fig. 6 with image from Fior et al., 2012
tail bud decreased cellular motility, abnormal WT + MO1-msgn1 standard conditions Fig. 5 with imageFig. 6 with image from Fior et al., 2012
somitogenesis arrested, abnormal tbx16b104/b104 + MO1-msgn1 standard conditions Fig. 1 with image from Fior et al., 2012
tail bud increased size, abnormal tbx16b104/b104 + MO1-msgn1 standard conditions Fig. 1 with image from Fior et al., 2012
post-vent region lacks all parts of type somite, abnormal tbx16b104/b104 + MO1-msgn1 standard conditions Fig. 1 with image from Fior et al., 2012
tail bud increased size, abnormal tbx16kt378b/kt378b + MO1-msgn1 standard conditions Fig. 1 with image from Yabe et al., 2012
somitogenesis disrupted, abnormal tbx16kt378b/kt378b + MO1-msgn1 standard conditions Fig. 1 with image from Yabe et al., 2012
somatic muscle development disrupted, abnormal tbx16kt378b/kt378b + MO1-msgn1 standard conditions Fig. 1 with image from Yabe et al., 2012
trunk somite absent, abnormal tbx16kt378b/kt378b + MO1-msgn1 standard conditions Fig. 1 with image from Yabe et al., 2012
post-vent region lacks all parts of type somite, abnormal tbx16kt378b/kt378b + MO1-msgn1 standard conditions Fig. 1 with image from Yabe et al., 2012
Citations