Morpholino
MO1-bmi1b
- ID
- ZDB-MRPHLNO-121120-7
- Name
- MO1-bmi1b
- Previous Names
- None
- Target
- Sequence
-
5' - CATTGTCATGGGAGTACGCCGACCT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-bmi1b
No data available
Phenotype
Phenotype resulting from MO1-bmi1b
No data available
Phenotype of all Fish created by or utilizing MO1-bmi1b
1 - 5 of 8 Show all
Citations
- Ray, M.K., Wiskow, O., King, M.J., Ismail, N., Ergun, A., Wang, Y., Plys, A.J., Davis, C.P., Kathrein, K., Sadreyev, R., Borowsky, M.L., Eggan, K., Zon, L., Galloway, J.L., Kingston, R.E. (2016) CAT7 and cat7l long non-coding RNAs Tune Polycomb Repressive Complex 1 Function During Human and Zebrafish Development. The Journal of biological chemistry. 291(37):19558-72
- Huang, H.T., Kathrein, K.L., Barton, A., Gitlin, Z., Huang, Y.H., Ward, T.P., Hofmann, O., Dibiase, A., Song, A., Tyekucheva, S., Hide, W., Zhou, Y., and Zon, L.I. (2013) A network of epigenetic regulators guides developmental haematopoiesis in vivo. Nature cell biology. 15(12):1516-1525
- Mochida, G.H., Ganesh, V.S., de Michelena, M.I., Dias, H., Atabay, K.D., Kathrein, K.L., Huang, H.T., Hill, R.S., Felie, J.M., Rakiec, D., Gleason, D., Hill, A.D., Malik, A.N., Barry, B.J., Partlow, J.N., Tan, W.H., Glader, L.J., Barkovich, A.J., Dobyns, W.B., Zon, L.I., and Walsh, C.A. (2012) CHMP1A encodes an essential regulator of BMI1-INK4A in cerebellar development. Nature Genetics. 44(11):1260-1264
1 - 3 of 3
Show