Morpholino

MO1-e2f7

ID
ZDB-MRPHLNO-121116-1
Name
MO1-e2f7
Previous Names
  • exon 2–intron 2-3 (1)
Target
Sequence
5' - GTGCATTTGGATAATCGTACTTTAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-e2f7
No data available
Phenotype
Phenotype resulting from MO1-e2f7
Phenotype of all Fish created by or utilizing MO1-e2f7
Phenotype Fish Conditions Figures
angiogenesis process quality, abnormal s843Tg + MO1-e2f7 standard conditions Fig. 1 from Weijts et al., 2012
dorsal longitudinal anastomotic vessel hypoplastic, abnormal s843Tg + MO1-e2f7 standard conditions Fig. 1 from Weijts et al., 2012
intersegmental artery branching involved in blood vessel morphogenesis decreased process quality, abnormal s843Tg + MO1-e2f7 standard conditions Fig. 1 from Weijts et al., 2012
intersegmental artery malformed, abnormal s843Tg + MO1-e2f7 standard conditions Fig. 1 from Weijts et al., 2012
whole organism e2f1 expression increased amount, abnormal WT + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 4 with image from de Bruin et al., 2016
head nrp1a expression increased amount, abnormal WT + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 4 with image from de Bruin et al., 2016
whole organism nrp1b expression decreased amount, abnormal WT + MO1-e2f7 + MO1-e2f8 hypoxia Fig. S5 from de Bruin et al., 2016
whole organism nrp1a expression decreased amount, abnormal WT + MO1-e2f7 + MO1-e2f8 hypoxia Fig. S5 from de Bruin et al., 2016
trunk motor neuron nrp1a expression increased amount, abnormal WT + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 4 with image from de Bruin et al., 2016
motor neuron axon truncated, abnormal js12Tg + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 6 from de Bruin et al., 2016
optic cup GFP expression increased amount, abnormal js12Tg + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 5 with image from de Bruin et al., 2016
motor neuron axon guidance decreased process quality, abnormal js12Tg + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 6 from de Bruin et al., 2016
retina GFP expression increased amount, abnormal js12Tg + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 5 with image from de Bruin et al., 2016
angiogenic sprout physical object quality, abnormal s843Tg + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 2 from Weijts et al., 2012
intersegmental artery malformed, abnormal s843Tg + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 1Fig. 2 from Weijts et al., 2012
angiogenesis process quality, abnormal s843Tg + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 1Fig. 2 from Weijts et al., 2012
intersegmental artery branching involved in blood vessel morphogenesis decreased process quality, abnormal s843Tg + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 1Fig. 2 from Weijts et al., 2012
dorsal longitudinal anastomotic vessel hypoplastic, abnormal s843Tg + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 1Fig. 2 from Weijts et al., 2012
angiogenesis process quality, abnormal s843Tg + MO1-e2f7 + MO1-e2f8 + MO1-vegfaa standard conditions Fig. 2 from Weijts et al., 2012
angiogenic sprout physical object quality, abnormal s843Tg + MO1-e2f7 + MO1-e2f8 + MO1-vegfaa standard conditions Fig. 2 from Weijts et al., 2012
intersegmental artery branching involved in blood vessel morphogenesis decreased process quality, abnormal s843Tg + MO1-e2f7 + MO1-e2f8 + MO1-vegfaa standard conditions Fig. 2 from Weijts et al., 2012
dorsal longitudinal anastomotic vessel hypoplastic, abnormal s843Tg + MO1-e2f7 + MO1-e2f8 + MO1-vegfaa standard conditions Fig. 2 from Weijts et al., 2012
intersegmental artery malformed, abnormal s843Tg + MO1-e2f7 + MO1-e2f8 + MO1-vegfaa standard conditions Fig. 2 from Weijts et al., 2012
thoracic duct lymphangiogenesis disrupted, abnormal hu5333Tg; y1Tg + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 2 with image from Weijts et al., 2013
lymphangioblast cord lymphangioblast decreased amount, abnormal hu5333Tg; y1Tg + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 2 with image from Weijts et al., 2013
intersegmental vein decreased amount, abnormal hu5333Tg; y1Tg + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 2 with image from Weijts et al., 2013
thoracic duct morphology, abnormal hu5333Tg; y1Tg + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 2 with image from Weijts et al., 2013
intersegmental vessel decreased amount, abnormal hu5333Tg; y1Tg + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 2 with image from Weijts et al., 2013
intersegmental vein angiogenic sprout decreased amount, abnormal hu5333Tg; y1Tg + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 2 with image from Weijts et al., 2013
intersegmental artery decreased amount, abnormal hu5333Tg; y1Tg + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 2 with image from Weijts et al., 2013
eye anatomical region hemorrhagic, abnormal s843Tg; sd2Tg + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 1 from Weijts et al., 2012
eye blood vessel malformed, abnormal s843Tg; sd2Tg + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 1 from Weijts et al., 2012
head hemorrhagic, abnormal s843Tg; sd2Tg + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 1 from Weijts et al., 2012
head blood vessel malformed, abnormal s843Tg; sd2Tg + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 1 from Weijts et al., 2012
intersegmental artery broken, abnormal s843Tg; sd2Tg + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 1 from Weijts et al., 2012
lymphangiogenesis disrupted, abnormal hu5333Tg; y1Tg + MO1-ccbe1 + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 3 with image from Weijts et al., 2013
thoracic duct morphology, abnormal hu5333Tg; y1Tg + MO1-ccbe1 + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 3 with image from Weijts et al., 2013
lymphangioblast cord lymphangioblast decreased amount, abnormal hu5333Tg; y1Tg + MO1-ccbe1 + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 3 with image from Weijts et al., 2013
dorsal longitudinal anastomotic vessel sprouting angiogenesis disrupted, abnormal hu5333Tg; y1Tg + MO1-ccbe1 + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 3 with image from Weijts et al., 2013
dorsal longitudinal anastomotic vessel separated from dorsal longitudinal anastomotic vessel, abnormal hu5333Tg; y1Tg + MO1-ccbe1 + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 3 with image from Weijts et al., 2013
intersegmental artery decreased amount, abnormal hu5333Tg; y1Tg + MO1-e2f7 + MO1-e2f8 + MO4-dll4 standard conditions Fig. 4 with image from Weijts et al., 2013
lymphangioblast decreased amount, abnormal hu5333Tg; y1Tg + MO1-e2f7 + MO1-e2f8 + MO4-dll4 standard conditions Fig. 4 with image from Weijts et al., 2013
intersegmental vessel increased branchiness, abnormal hu5333Tg; y1Tg + MO1-e2f7 + MO1-e2f8 + MO4-dll4 standard conditions Fig. 4 with image from Weijts et al., 2013
thoracic duct absent, abnormal hu5333Tg; y1Tg + MO1-e2f7 + MO1-e2f8 + MO4-dll4 standard conditions Fig. 4 with image from Weijts et al., 2013
sprouting angiogenesis disrupted, abnormal hu5333Tg; y1Tg + MO1-e2f7 + MO1-e2f8 + MO4-dll4 standard conditions Fig. 4 with image from Weijts et al., 2013
lymphangioblast cord lymphangioblast decreased amount, abnormal hu5333Tg; y1Tg + MO1-e2f7 + MO1-e2f8 + MO4-dll4 standard conditions Fig. 4 with image from Weijts et al., 2013
lymphangiogenesis disrupted, abnormal hu5333Tg; y1Tg + MO1-e2f7 + MO1-e2f8 + MO4-dll4 standard conditions Fig. 4 with image from Weijts et al., 2013
motor neuron axon truncated, ameliorated nrp1ahu10012/hu10012; js12Tg + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 6 from de Bruin et al., 2016
motor neuron axon guidance decreased process quality, ameliorated nrp1ahu10012/hu10012; js12Tg + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 6 from de Bruin et al., 2016
Citations