Morpholino

MO3-ctnnd1

ID
ZDB-MRPHLNO-121031-9
Name
MO3-ctnnd1
Previous Names
None
Target
Sequence
5' - CTAGCATGTACTCACAGTCCAGCGG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-ctnnd1
No data available
Phenotype
Phenotype resulting from MO3-ctnnd1
Phenotype Fish Figures
axis elongation disrupted, abnormal WIK/AB + MO3-ctnnd1 Fig. 1 from Kupai et al., 2022
brain development disrupted, abnormal WT + MO3-ctnnd1 Fig. 5 with image from Hsu et al., 2012
cell adhesion disrupted, abnormal WIK/AB + MO3-ctnnd1 Fig. 1 from Shan et al., 2022
embryo development disrupted, abnormal WIK/AB + MO3-ctnnd1 Fig. 1 from Shan et al., 2022
extension morphology, abnormal WT + MO3-ctnnd1 Fig. 5 with image from Hsu et al., 2012
eye development disrupted, abnormal WT + MO3-ctnnd1 Fig. 5 with image from Hsu et al., 2012
notochord shortened, abnormal WT + MO3-ctnnd1 Fig. 3 with image from Hsu et al., 2012
paraxial mesoderm anatomical compartment boundary disorganized, abnormal WT + MO3-ctnnd1 Fig. 4 with image from Hsu et al., 2012
paraxial mesoderm anatomical compartment boundary distributed, abnormal WT + MO3-ctnnd1 Fig. 4 with image from Hsu et al., 2012
post-vent region decreased length, abnormal WT + MO3-ctnnd1 Fig. 1 from Kupai et al., 2022
Fig. 5 with image from Hsu et al., 2012
post-vent region shortened, abnormal WIK/AB + MO3-ctnnd1 Fig. 1 from Shan et al., 2022
somite broad, abnormal WIK/AB + MO3-ctnnd1 Fig. 3 from Shan et al., 2022
somite decreased thickness, abnormal WT + MO3-ctnnd1 Fig. 3 with image from Hsu et al., 2012
somite increased length, abnormal WT + MO3-ctnnd1 Fig. 3 with image from Hsu et al., 2012
somite shortened, abnormal WIK/AB + MO3-ctnnd1 Fig. 3 from Shan et al., 2022
somitogenesis disrupted, abnormal WT + MO3-ctnnd1 Fig. 3 with image,  Fig. 5 with image from Hsu et al., 2012
whole organism dead, abnormal WIK/AB + MO3-ctnnd1 Fig. 1 from Kupai et al., 2022
whole organism malformed, abnormal WT + MO3-ctnnd1 Fig. 5 with image from Hsu et al., 2012
whole organism anatomical axis shortened, abnormal WT + MO3-ctnnd1 Fig. 5 with image from Hsu et al., 2012
Phenotype of all Fish created by or utilizing MO3-ctnnd1
Phenotype Fish Conditions Figures
post-vent region decreased length, abnormal WIK/AB + MO3-ctnnd1 standard conditions Fig. 1 from Kupai et al., 2022
somite broad, abnormal WIK/AB + MO3-ctnnd1 standard conditions Fig. 3 from Shan et al., 2022
post-vent region shortened, abnormal WIK/AB + MO3-ctnnd1 standard conditions Fig. 1 from Shan et al., 2022
whole organism dead, abnormal WIK/AB + MO3-ctnnd1 standard conditions Fig. 1 from Kupai et al., 2022
cell adhesion disrupted, abnormal WIK/AB + MO3-ctnnd1 standard conditions Fig. 1 from Shan et al., 2022
somite shortened, abnormal WIK/AB + MO3-ctnnd1 standard conditions Fig. 3 from Shan et al., 2022
embryo development disrupted, abnormal WIK/AB + MO3-ctnnd1 standard conditions Fig. 1 from Shan et al., 2022
axis elongation disrupted, abnormal WIK/AB + MO3-ctnnd1 standard conditions Fig. 1 from Kupai et al., 2022
notochord shortened, abnormal WT + MO3-ctnnd1 standard conditions Fig. 3 with image from Hsu et al., 2012
post-vent region decreased length, abnormal WT + MO3-ctnnd1 standard conditions Fig. 5 with image from Hsu et al., 2012
extension morphology, abnormal WT + MO3-ctnnd1 standard conditions Fig. 5 with image from Hsu et al., 2012
brain development disrupted, abnormal WT + MO3-ctnnd1 standard conditions Fig. 5 with image from Hsu et al., 2012
eye development disrupted, abnormal WT + MO3-ctnnd1 standard conditions Fig. 5 with image from Hsu et al., 2012
somite decreased thickness, abnormal WT + MO3-ctnnd1 standard conditions Fig. 3 with image from Hsu et al., 2012
paraxial mesoderm anatomical compartment boundary distributed, abnormal WT + MO3-ctnnd1 standard conditions Fig. 4 with image from Hsu et al., 2012
whole organism anatomical axis shortened, abnormal WT + MO3-ctnnd1 standard conditions Fig. 5 with image from Hsu et al., 2012
paraxial mesoderm anatomical compartment boundary disorganized, abnormal WT + MO3-ctnnd1 standard conditions Fig. 4 with image from Hsu et al., 2012
somitogenesis disrupted, abnormal WT + MO3-ctnnd1 standard conditions Fig. 3 with image,  Fig. 5 with image from Hsu et al., 2012
somite increased length, abnormal WT + MO3-ctnnd1 standard conditions Fig. 3 with image from Hsu et al., 2012
whole organism malformed, abnormal WT + MO3-ctnnd1 standard conditions Fig. 5 with image from Hsu et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.