header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-121010-2
Morpholino Name: MO1-atg5
Target: atg5 (1)
Previous Name: 5MOatg5 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CATCCTTGTCATCTGCCATTATCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-atg5 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-atg5
Expressed Gene Anatomy Figures
atg5 Fig. 4 from Hu et al., 2011
atg12 Fig. 4 from Hu et al., 2011
elavl3 Fig. 5 from Hu et al., 2011
gli1 Fig. 5 from Hu et al., 2011
map1lc3b Fig. 6 with image from Boglev et al., 2013
necab1 Fig. 5 from Hu et al., 2011
neurog1 Fig. 5 from Hu et al., 2011
nkx2.2a Fig. 5 from Hu et al., 2011
park7 Fig. 5 from Hu et al., 2011
pink1 Fig. 5 from Hu et al., 2011
slc6a3 Fig. 6 from Hu et al., 2017
sncb Fig. 5 from Hu et al., 2011
th Fig. 4Fig. 5 from Hu et al., 2017
uchl1 Fig. 5 from Hu et al., 2011
zic1 Fig. 5 from Hu et al., 2011
PHENOTYPE
Phenotype resulting from MO1-atg5
Phenotype Figures
blood decreased volume, abnormal Fig. 3 from Hu et al., 2011
common cardinal vein congested, abnormal Fig. 3 from Hu et al., 2011
diencephalon dopaminergic neuron decreased amount, abnormal Fig. 5Fig. 6 from Hu et al., 2017
dopaminergic neuron decreased amount, abnormal Fig. 4 from Hu et al., 2017
embryo development disrupted, abnormal Fig. 3 from Hu et al., 2011
extension decreased length, abnormal Fig. 3 from Hu et al., 2011
eye decreased size, abnormal Fig. 3 from Hu et al., 2011
eye hypoplastic, abnormal Fig. 3 from Hu et al., 2011
eye development disrupted, abnormal Fig. 3 from Hu et al., 2011
head decreased size, abnormal Fig. 3 from Hu et al., 2011
head hypoplastic, abnormal Fig. 3 from Hu et al., 2011
heart structure, abnormal Fig. 3 from Hu et al., 2011
otolith decreased amount, abnormal Fig. 3 from Hu et al., 2011
post-vent region decreased length, abnormal Fig. 3 from Hu et al., 2011
somite structure, abnormal Fig. 3 from Hu et al., 2011
swimming decreased process quality, abnormal Fig. 7 from Hu et al., 2017
trunk decreased length, abnormal Fig. 3 from Hu et al., 2011
whole organism dead, abnormal Fig. 2 from Mans et al., 2017
whole organism ab1-atg5 labeling decreased amount, abnormal Fig. 3 from Hu et al., 2017
whole organism Ab5-map1lc3b labeling decreased amount, abnormal Fig. 3 from Hu et al., 2017
whole organism ab3-th labeling decreased amount, abnormal Fig. 3 from Hu et al., 2017
whole organism decreased life span, abnormal Fig. 2 from Mans et al., 2017
whole organism Ab1-park8 labeling increased amount, abnormal Fig. 3 from Hu et al., 2017
whole organism ab4-sqstm1 labeling increased amount, abnormal Fig. 3 from Hu et al., 2017
whole organism Ab2-pink1 labeling increased amount, abnormal Fig. 3 from Hu et al., 2017
whole organism ab2-sncb labeling increased amount, abnormal Fig. 3 from Hu et al., 2017
whole organism morphology, abnormal Fig. 3 from Hu et al., 2011
whole organism viability, abnormal Fig. 3 from Hu et al., 2011
yolk vacuolated, abnormal Fig. 3 from Hu et al., 2011

Phenotype of all Fish created by or utilizing MO1-atg5
Phenotype Fish Conditions Figures
swimming decreased process quality, abnormal AB + MO1-atg5 control Fig. 7 from Hu et al., 2017
diencephalon dopaminergic neuron decreased amount, abnormal AB + MO1-atg5 control Fig. 5Fig. 6 from Hu et al., 2017
whole organism ab3-th labeling decreased amount, abnormal AB + MO1-atg5 control Fig. 3 from Hu et al., 2017
dopaminergic neuron decreased amount, exacerbated AB + MO1-atg5 chemical treatment by environment: 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine Fig. 4 from Hu et al., 2017
whole organism Ab5-map1lc3b labeling decreased amount, abnormal AB + MO1-atg5 control Fig. 3 from Hu et al., 2017
dopaminergic neuron decreased amount, abnormal AB + MO1-atg5 control Fig. 4 from Hu et al., 2017
swimming decreased process quality, exacerbated AB + MO1-atg5 chemical treatment by environment: 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine Fig. 7 from Hu et al., 2017
diencephalon dopaminergic neuron decreased amount, exacerbated AB + MO1-atg5 chemical treatment by environment: 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine Fig. 5Fig. 6 from Hu et al., 2017
whole organism ab1-atg5 labeling decreased amount, abnormal AB + MO1-atg5 control Fig. 3 from Hu et al., 2017
whole organism ab2-sncb labeling increased amount, abnormal AB + MO1-atg5 control Fig. 3 from Hu et al., 2017
whole organism Ab1-park8 labeling increased amount, abnormal AB + MO1-atg5 control Fig. 3 from Hu et al., 2017
whole organism Ab2-pink1 labeling increased amount, abnormal AB + MO1-atg5 control Fig. 3 from Hu et al., 2017
whole organism ab4-sqstm1 labeling increased amount, abnormal AB + MO1-atg5 control Fig. 3 from Hu et al., 2017
post-vent region decreased length, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
extension decreased length, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
eye hypoplastic, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
otolith decreased amount, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
eye decreased size, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
trunk decreased length, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
whole organism viability, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
heart structure, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
head hypoplastic, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
eye development disrupted, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
common cardinal vein congested, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
whole organism morphology, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
yolk vacuolated, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
head decreased size, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
embryo development disrupted, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
somite structure, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
blood decreased volume, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
lateral rectus regenerating tissue decreased length, abnormal WT + MO1-atg5 resection: lateral rectus Fig. 3 with image from Saera-Vila et al., 2016
whole organism decreased life span, abnormal WT + MO1-atg5 standard conditions Fig. 2 from Mans et al., 2017
lateral rectus skeletal muscle tissue regeneration decreased process quality, abnormal WT + MO1-atg5 resection: lateral rectus Fig. 3 with image from Saera-Vila et al., 2016
whole organism dead, abnormal WT + MO1-atg5 standard conditions Fig. 2 from Mans et al., 2017
lateral rectus regenerating tissue EGFP expression decreased amount, abnormal zf155Tg + MO1-atg5 resection: lateral rectus Fig. 3 with image from Saera-Vila et al., 2016
autophagy disrupted, abnormal zf155Tg + MO1-atg5 resection: lateral rectus Fig. 3 with image from Saera-Vila et al., 2016
intestine cell hypotrophic, abnormal pwp2hs450/s450 + MO1-atg5 standard conditions Fig. 6 with image from Boglev et al., 2013
intestinal epithelium cell detached from intestine, abnormal pwp2hs450/s450 + MO1-atg5 standard conditions Fig. 6 with image from Boglev et al., 2013
whole organism dead, abnormal pwp2hs450/s450 + MO1-atg5 standard conditions Fig. 6 with image from Boglev et al., 2013
eye edematous, abnormal pwp2hs450/s450 + MO1-atg5 standard conditions Fig. S7 with image from Boglev et al., 2013
head edematous, abnormal pwp2hs450/s450 + MO1-atg5 standard conditions Fig. S7 with image from Boglev et al., 2013
intestine edematous, abnormal pwp2hs450/s450 + MO1-atg5 standard conditions Fig. S7 with image from Boglev et al., 2013
heart edematous, abnormal pwp2hs450/s450 + MO1-atg5 standard conditions Fig. S7 with image from Boglev et al., 2013
whole organism decreased life span, abnormal stk11hu1968/hu1968 + MO1-atg5 standard conditions Fig. 2 from Mans et al., 2017
whole organism dead, abnormal stk11hu1968/hu1968 + MO1-atg5 standard conditions Fig. 2 from Mans et al., 2017
Genome Resources:
CITATIONS (6)